ID: 1076354030

View in Genome Browser
Species Human (GRCh38)
Location 10:129839509-129839531
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076354025_1076354030 -4 Left 1076354025 10:129839490-129839512 CCGTGTGGCCTCATCTGTGGACA 0: 1
1: 0
2: 1
3: 14
4: 251
Right 1076354030 10:129839509-129839531 GACAGCTGTGCCCTCGGGGCCGG No data
1076354023_1076354030 -2 Left 1076354023 10:129839488-129839510 CCCCGTGTGGCCTCATCTGTGGA No data
Right 1076354030 10:129839509-129839531 GACAGCTGTGCCCTCGGGGCCGG No data
1076354024_1076354030 -3 Left 1076354024 10:129839489-129839511 CCCGTGTGGCCTCATCTGTGGAC 0: 1
1: 0
2: 2
3: 22
4: 207
Right 1076354030 10:129839509-129839531 GACAGCTGTGCCCTCGGGGCCGG No data
1076354020_1076354030 2 Left 1076354020 10:129839484-129839506 CCCACCCCGTGTGGCCTCATCTG 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1076354030 10:129839509-129839531 GACAGCTGTGCCCTCGGGGCCGG No data
1076354017_1076354030 27 Left 1076354017 10:129839459-129839481 CCAGGCGCTGGGCAGGCACAGGG 0: 1
1: 1
2: 7
3: 79
4: 768
Right 1076354030 10:129839509-129839531 GACAGCTGTGCCCTCGGGGCCGG No data
1076354021_1076354030 1 Left 1076354021 10:129839485-129839507 CCACCCCGTGTGGCCTCATCTGT No data
Right 1076354030 10:129839509-129839531 GACAGCTGTGCCCTCGGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr