ID: 1076355477

View in Genome Browser
Species Human (GRCh38)
Location 10:129849703-129849725
Sequence CTGTGCGGACCTTTATCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076355477 Original CRISPR CTGTGCGGACCTTTATCTCC GGG (reversed) Intronic
906370022 1:45245845-45245867 TTGTGCTCAACTTTATCTCCAGG - Intronic
906583469 1:46955602-46955624 CTCAGAGGACCTTCATCTCCTGG - Intergenic
906957203 1:50384416-50384438 CTGTGCTGAACTTGAACTCCTGG + Intergenic
907301778 1:53491373-53491395 ATATGCCCACCTTTATCTCCTGG - Intergenic
910558943 1:88568983-88569005 CTCTTTGGACCTTTATTTCCAGG - Intergenic
911101846 1:94101605-94101627 CTGTGCAGACCTTGATCTCAGGG + Intronic
919788228 1:201273836-201273858 GTTTCCGGTCCTTTATCTCCTGG - Intergenic
1063301182 10:4850190-4850212 CTCTGTGGACCTTGGTCTCCAGG - Intergenic
1065740497 10:28792658-28792680 CTGAGCGGCCCTTTGGCTCCTGG + Intergenic
1069172402 10:65248722-65248744 CTTTGTGGACCTTTACCTCCAGG - Intergenic
1075169812 10:120102842-120102864 CTGTGTGTACCTTTCTTTCCAGG + Intergenic
1076355477 10:129849703-129849725 CTGTGCGGACCTTTATCTCCGGG - Intronic
1076757852 10:132583356-132583378 ATGTGAGCACCTTTTTCTCCAGG + Intronic
1076914968 10:133418844-133418866 CTGTGCTGGCCTTTCCCTCCAGG + Intronic
1080614866 11:33937132-33937154 CTATGAGGCCCTTTATCACCGGG - Intergenic
1081750598 11:45508156-45508178 CTGTGTTGACCTTGATTTCCCGG - Intergenic
1090632182 11:128659426-128659448 CTGTGATTAGCTTTATCTCCAGG + Intergenic
1091672853 12:2465578-2465600 CACTGCGGACTTTTGTCTCCTGG - Intronic
1100708614 12:97229044-97229066 CTGTGAGGCCCTTCATCACCTGG + Intergenic
1114384354 14:22240416-22240438 CTCAGAGGACCTTCATCTCCTGG - Intergenic
1120581355 14:86254700-86254722 TTGTGCAGGCCTTTCTCTCCAGG + Intergenic
1122726673 14:103759513-103759535 CTGTGCTGGCCTCAATCTCCTGG + Intronic
1127640745 15:60913522-60913544 CTGTGCTGTCCTTTATCTCAGGG + Intronic
1130518617 15:84645348-84645370 CTGTGAGCAACTTTAACTCCTGG + Intronic
1138495116 16:57404126-57404148 CTCTGCCCACCTGTATCTCCTGG - Intergenic
1139907074 16:70373643-70373665 CTGTCCCGGCATTTATCTCCTGG + Intergenic
1146995957 17:37321288-37321310 CTGTGCAGACCTTTATCCTTGGG - Intronic
1148990887 17:51666304-51666326 CTGTCCTTACCTTTTTCTCCTGG - Intronic
1150148130 17:62788207-62788229 GTGTCAGGACCTTTATCTACAGG + Intronic
1151523495 17:74647853-74647875 CGGTGGTGTCCTTTATCTCCAGG - Intergenic
1155100614 18:22606835-22606857 CTGTGCTCACCGTCATCTCCTGG + Intergenic
1155314116 18:24554135-24554157 CAGTTCTGACCTTTATCTCCAGG + Intergenic
1159119254 18:64150288-64150310 CGGTGCGGAGCTTTCTGTCCTGG + Intergenic
1160903023 19:1438614-1438636 CTGTCCGGGCCTTCATGTCCGGG + Intronic
1164262402 19:23579508-23579530 CTGTATGGACCTTTTTCTCTTGG + Intronic
1165700795 19:37935901-37935923 CTGTGGGCACCTTTCTATCCTGG + Intronic
1166877005 19:45903261-45903283 CTGTGCGCACCTTTACCTCGAGG + Intergenic
927235576 2:20871493-20871515 CTGTGCAGACATTTATCAACAGG + Intergenic
927239783 2:20911264-20911286 CTGTGCGGGACATAATCTCCTGG + Intergenic
930872411 2:56183260-56183282 CTGTGCTGACCTTAAAATCCAGG + Intergenic
931086188 2:58833098-58833120 TTGTGCCCACCTTTATCACCAGG + Intergenic
932083692 2:68738615-68738637 GTGTGGGGACCTTTATCTATCGG - Intronic
935149755 2:100423228-100423250 CTGGGCTGACCTTGAACTCCTGG + Intergenic
935507125 2:103919483-103919505 CTGTGCCAATCTTTATCACCGGG + Intergenic
935706041 2:105858456-105858478 CTGGGCTGATCTTTAACTCCTGG + Intronic
946131217 2:217608498-217608520 CTGTACAGACCTTCAACTCCAGG + Intronic
947137357 2:226988372-226988394 CTGTTCTGACCTTTATCTTGGGG - Intronic
1172621550 20:36321018-36321040 CTTTGAGGGCCTTCATCTCCAGG - Intronic
1175215755 20:57391168-57391190 CTGGGCGCGCCTTTCTCTCCTGG - Intergenic
1181275640 22:21686230-21686252 CTGTGTGGTATTTTATCTCCAGG + Intronic
1181521414 22:23450634-23450656 CTGTGCTGACCTCTAACCCCGGG + Intergenic
949871945 3:8596559-8596581 CTGTGGGCCCTTTTATCTCCAGG + Intergenic
950742848 3:15063865-15063887 CTGTGCACACCTTTGTCCCCGGG - Intronic
952902840 3:38121228-38121250 CTGTGCCCTCCTCTATCTCCTGG - Intronic
953256994 3:41300577-41300599 CTGTGTGAACCTTTATCTTAAGG + Intronic
953432525 3:42851577-42851599 CAGTGCAGAGCTTTCTCTCCAGG + Intronic
969861267 4:10037411-10037433 CTGGGCAAACCTTTTTCTCCTGG + Intronic
970424066 4:15930345-15930367 CTGTGGGTAACTTCATCTCCAGG + Intergenic
979949175 4:126870914-126870936 CAGTGAGGAACTTTAGCTCCTGG + Intergenic
984499338 4:180538510-180538532 CTGAGCAGACCTTCCTCTCCTGG - Intergenic
986096453 5:4559119-4559141 CTGTGAGGACCTGCATCTGCTGG + Intergenic
992806378 5:80342081-80342103 CTGGGCTGACCTTGAACTCCTGG - Intergenic
997883602 5:137611944-137611966 CTGTGCGGACCTGTTTGTCCTGG + Intergenic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1010937760 6:81882240-81882262 CTGTTGGGACCTTTTTCTCCTGG - Intergenic
1011971684 6:93232708-93232730 CTGTTCTGACCCTTCTCTCCAGG - Intergenic
1014279678 6:119427820-119427842 CTGTGATGACCTTTATTCCCTGG + Intergenic
1019129636 6:169864336-169864358 CTCTGTGGACCTGTCTCTCCCGG - Intergenic
1020654179 7:10910058-10910080 CTGTGCTGGCCTTCAACTCCTGG + Intergenic
1021261386 7:18461681-18461703 CATTGCCTACCTTTATCTCCAGG + Intronic
1029352382 7:100023449-100023471 CTGTGCTCACCTTTATGTCCTGG - Exonic
1030273768 7:107697633-107697655 CTCTGCTGCCCTTTACCTCCAGG + Intronic
1031121484 7:117727402-117727424 CTGGGCTGACCTTTAACTCCTGG + Intronic
1032433986 7:131885249-131885271 CTGTGCAAACCCTTGTCTCCAGG + Intergenic
1033536090 7:142313233-142313255 CTGTGCGGTTCTCTGTCTCCTGG + Intergenic
1033539755 7:142345552-142345574 CTGTGCGGTTCTCTGTCTCCTGG + Intergenic
1033544331 7:142386204-142386226 CTGTGTGACCCTTTGTCTCCTGG + Intergenic
1033545033 7:142391958-142391980 CTGTGTGGCCTTTTGTCTCCTGG + Intergenic
1033547543 7:142415241-142415263 CTGTGTGTCCCTTTATATCCTGG + Intergenic
1033549521 7:142433976-142433998 CTGGGCGGCCCTCTGTCTCCTGG + Intergenic
1033566262 7:142581001-142581023 CTGTGTGGTTCTTTGTCTCCTGG + Intergenic
1033570091 7:142619077-142619099 CTGTGTGGTCCTTTGTCTCCTGG + Intergenic
1033572509 7:142645981-142646003 CTGTGCAGCCCTGTGTCTCCTGG + Intergenic
1033573449 7:142656757-142656779 CTGTGGGGCCTTTTATCTCCTGG + Intergenic
1036229587 8:6988334-6988356 CTCTGCAGACCTATATATCCAGG - Intergenic
1036232038 8:7007437-7007459 CTCTGCAGACCTATATATCCAGG - Intronic
1040700945 8:50064742-50064764 CTGACCGGACGTTTACCTCCTGG + Intronic
1046199004 8:110897501-110897523 CAGTGAGGACCTTAATCTCTAGG - Intergenic
1050635682 9:7609892-7609914 CTCTGTGGACCATTTTCTCCAGG + Intergenic
1052886053 9:33649151-33649173 CTGTGTGGCCTTTTGTCTCCTGG + Intergenic
1053185273 9:36011011-36011033 ATGTGAGGTTCTTTATCTCCTGG - Intergenic
1055573440 9:77640100-77640122 CTCTGCAGACCTTTATAGCCAGG - Intronic
1056529108 9:87471187-87471209 CTGTTGGACCCTTTATCTCCTGG + Intergenic
1057862643 9:98653809-98653831 CAGTGCTGACCTTTAGCTCATGG + Intronic
1189207493 X:39254392-39254414 CTGGGCAGGCCTTTATCTGCTGG + Intergenic
1189260946 X:39678492-39678514 CAGTGGGGACATTTATCACCCGG + Intergenic
1194516023 X:94855030-94855052 CTGTGAGGTGATTTATCTCCAGG - Intergenic
1198740300 X:139835264-139835286 CTATTAGGACCTTGATCTCCTGG - Intronic
1201857842 Y:18564982-18565004 CTATGCTGACCTTTCTCTTCTGG + Intronic
1201875479 Y:18755399-18755421 CTATGCTGACCTTTCTCTTCTGG - Intronic