ID: 1076356411

View in Genome Browser
Species Human (GRCh38)
Location 10:129856968-129856990
Sequence CTGTGCTTTTACACAGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 215}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076356411_1076356415 -10 Left 1076356411 10:129856968-129856990 CCAGTGCCTGTGTAAAAGCACAG 0: 1
1: 0
2: 2
3: 15
4: 215
Right 1076356415 10:129856981-129857003 AAAAGCACAGGGCTCCGCACAGG No data
1076356411_1076356425 30 Left 1076356411 10:129856968-129856990 CCAGTGCCTGTGTAAAAGCACAG 0: 1
1: 0
2: 2
3: 15
4: 215
Right 1076356425 10:129857021-129857043 CCAGCAGTGGGGGAAGGGCCTGG No data
1076356411_1076356422 25 Left 1076356411 10:129856968-129856990 CCAGTGCCTGTGTAAAAGCACAG 0: 1
1: 0
2: 2
3: 15
4: 215
Right 1076356422 10:129857016-129857038 AGAGCCCAGCAGTGGGGGAAGGG No data
1076356411_1076356419 19 Left 1076356411 10:129856968-129856990 CCAGTGCCTGTGTAAAAGCACAG 0: 1
1: 0
2: 2
3: 15
4: 215
Right 1076356419 10:129857010-129857032 CAAGACAGAGCCCAGCAGTGGGG No data
1076356411_1076356418 18 Left 1076356411 10:129856968-129856990 CCAGTGCCTGTGTAAAAGCACAG 0: 1
1: 0
2: 2
3: 15
4: 215
Right 1076356418 10:129857009-129857031 ACAAGACAGAGCCCAGCAGTGGG No data
1076356411_1076356421 24 Left 1076356411 10:129856968-129856990 CCAGTGCCTGTGTAAAAGCACAG 0: 1
1: 0
2: 2
3: 15
4: 215
Right 1076356421 10:129857015-129857037 CAGAGCCCAGCAGTGGGGGAAGG No data
1076356411_1076356420 20 Left 1076356411 10:129856968-129856990 CCAGTGCCTGTGTAAAAGCACAG 0: 1
1: 0
2: 2
3: 15
4: 215
Right 1076356420 10:129857011-129857033 AAGACAGAGCCCAGCAGTGGGGG No data
1076356411_1076356417 17 Left 1076356411 10:129856968-129856990 CCAGTGCCTGTGTAAAAGCACAG 0: 1
1: 0
2: 2
3: 15
4: 215
Right 1076356417 10:129857008-129857030 AACAAGACAGAGCCCAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076356411 Original CRISPR CTGTGCTTTTACACAGGCAC TGG (reversed) Intronic
900484706 1:2916805-2916827 CTGTGCTTTTGCTCAGGTGCTGG + Intergenic
904836539 1:33341232-33341254 CTGAGCTTGGACACAGGCAGTGG + Intronic
906847491 1:49209032-49209054 CTTTTCTTTTACACATGCCCTGG - Intronic
907723703 1:56998963-56998985 CTGTGGTTTTAAGCATGCACAGG + Intronic
911022396 1:93401811-93401833 CTATGCTTTAGCACAGGGACTGG + Intergenic
912073083 1:105838826-105838848 CTATGCTTTTGCAAAGACACTGG + Intergenic
912705187 1:111906315-111906337 CTGTGCTGTTTCCCAGGCAGAGG - Intronic
916489474 1:165288722-165288744 CTGTGCTCACACACAGGCTCAGG + Intronic
916694168 1:167220410-167220432 CCGTGCTTTTACAATGCCACAGG + Intergenic
918240165 1:182613975-182613997 CTGTACTTTTACACAGCCTATGG - Intergenic
918780524 1:188694037-188694059 CTGTGCTTTTTCAAAGCAACAGG - Intergenic
919338179 1:196266977-196266999 CTGTGTTGTTACAGAGGCATAGG - Intronic
919945916 1:202318892-202318914 CTGTGATTCTACCCAGGCCCTGG + Exonic
921193520 1:212730513-212730535 CCAATCTTTTACACAGGCACAGG + Intronic
922146612 1:222951907-222951929 CAGTGCTTTTACAGAGGCACAGG + Intronic
923339167 1:232993305-232993327 CTGTGCTTTAACAAAGAGACTGG + Intronic
1065921900 10:30400051-30400073 CTTTGCCTTTTCACAGGCAGAGG - Intergenic
1067484629 10:46635984-46636006 CTTTGTTTTTACACATACACAGG - Intergenic
1067610129 10:47705663-47705685 CTTTGTTTTTACACATACACAGG + Intergenic
1068163076 10:53293163-53293185 CTGTGCTTTAACAAAGAGACTGG + Intergenic
1071625712 10:87167302-87167324 CTTTGTTTTTACACATACACAGG + Intronic
1073242623 10:102068046-102068068 GTGTGTTTTTAAACAGGTACAGG + Intergenic
1076356411 10:129856968-129856990 CTGTGCTTTTACACAGGCACTGG - Intronic
1078075684 11:8158274-8158296 CTGTGCTATTCCACAGGAACAGG + Intronic
1079229232 11:18634987-18635009 CTGTGTTTTTGCTCAGGCAATGG + Intergenic
1079801317 11:24873139-24873161 CTGTGCTTTTAGACTAGCACTGG - Intronic
1083852724 11:65377458-65377480 CTTTGCTATTTCACAGTCACAGG - Intronic
1087695539 11:101371514-101371536 CCTTGCTTTTAAACAGGCATGGG + Intergenic
1089358601 11:117872032-117872054 CTGTGCTTATTAATAGGCACTGG + Intronic
1090881918 11:130840638-130840660 CTGTGTTTTAAGACAGCCACAGG + Intergenic
1092091176 12:5804872-5804894 CTGTTTTCTTACACAGGCAATGG + Intronic
1092559688 12:9599025-9599047 CTGTGCAGTGAAACAGGCACTGG - Intronic
1094560344 12:31547120-31547142 CTGAGATTGCACACAGGCACAGG - Intronic
1095593856 12:43937045-43937067 GTGTGGTTTTAAAAAGGCACAGG + Intronic
1098159047 12:67630534-67630556 GTGAGCTATTACACAGGCAGTGG + Intergenic
1103751249 12:123164513-123164535 CTGTGTTTTTTCACAGGTCCAGG - Intronic
1104134338 12:125923218-125923240 TTTTACTTTTACACAGGCAGAGG + Intergenic
1104266036 12:127233229-127233251 CTGTGCTCTTACCCATGCACTGG + Intergenic
1104808133 12:131602534-131602556 CTGTGCTTTAACAAAGAGACTGG - Intergenic
1104881803 12:132076872-132076894 CTGTGGTTTTAGGGAGGCACAGG + Intronic
1105581455 13:21700653-21700675 CTGAGCCTTGCCACAGGCACAGG + Intronic
1108245662 13:48510629-48510651 CTGTCCTTTTCCACAGTGACAGG + Exonic
1108984917 13:56574862-56574884 CTGTGCTTTTACACAGTGGAAGG + Intergenic
1109280986 13:60355240-60355262 CTGTGGTTTAACAGAGACACAGG - Intergenic
1109664140 13:65508036-65508058 CTGTGACATTACACAGACACTGG + Intergenic
1110039205 13:70730752-70730774 CTGTCATTCCACACAGGCACTGG + Intergenic
1110738827 13:78970185-78970207 CTGTGCTTTTAGACATCTACTGG + Intergenic
1112185869 13:97127240-97127262 GTGGCCTTTTACACAGGCTCAGG + Intergenic
1113563833 13:111305504-111305526 CTGTGCTTGTCCACATGCGCTGG + Intronic
1116027891 14:39536873-39536895 CTTTGCTTTTTCACAGCCTCAGG + Intergenic
1116221254 14:42091102-42091124 GTTTGCTTTTTCACATGCACAGG - Intergenic
1117997245 14:61489423-61489445 ATGTCCTCTTGCACAGGCACAGG - Intronic
1120476657 14:84997479-84997501 CTGTCCTTTTACAAAAGCAATGG - Intergenic
1121658533 14:95616752-95616774 ATATGCTCTTACACAGGAACAGG - Intergenic
1122037374 14:98958474-98958496 GTGGGCTTTTACACACGGACGGG + Intergenic
1128470290 15:67946074-67946096 CTGTGCGTTGCCCCAGGCACAGG + Intergenic
1130094331 15:80844767-80844789 CTGTGTTTCTACACAGCCTCAGG - Intronic
1131954077 15:97712635-97712657 CTATGCTTTTAAACAGTCAAAGG + Intergenic
1134039407 16:11056610-11056632 TTGTGGTTTTACAAAGGAACAGG - Intronic
1135278489 16:21134031-21134053 CAGTGCTTAGAGACAGGCACAGG + Intronic
1139547218 16:67655057-67655079 CTTGGCTTTGACCCAGGCACAGG + Intronic
1141171340 16:81693607-81693629 ATGTGTTTATACACAGGCAATGG - Intronic
1141580616 16:84995818-84995840 CTCTGCTTTGCCACATGCACAGG + Intronic
1141680352 16:85540326-85540348 CTGTCCTTTCACACAGGGGCTGG + Intergenic
1142219098 16:88844351-88844373 AAGTGCTTTTAAACAGGCAGTGG + Intronic
1143394177 17:6578979-6579001 CTGTACCTTCACCCAGGCACAGG + Exonic
1147494090 17:40899247-40899269 GTGTGCTTTTAAAAAGCCACTGG - Intergenic
1148247406 17:46042933-46042955 CTGTGTTTTTACACTTGGACAGG - Intronic
1149082294 17:52673706-52673728 GTGTGCGTTTACAGAGGCCCAGG + Intergenic
1150881105 17:69029369-69029391 ATTTTCTTTCACACAGGCACTGG + Intronic
1151976615 17:77487221-77487243 GTGTGGGTTTACACAGTCACTGG + Intronic
1154508788 18:15071450-15071472 AAGTGCTATTAGACAGGCACTGG + Intergenic
1156178335 18:34573973-34573995 ATGTGCTTTCACACAAGCACTGG + Intronic
1156977205 18:43237580-43237602 CTCTCCTTTTCCACAGGCAGAGG + Intergenic
1158229352 18:55236263-55236285 CTGTGTTGCGACACAGGCACCGG - Intronic
1158282806 18:55845827-55845849 CTGTGCTTTTTCTTAGGCAGAGG - Intergenic
1158913950 18:62100721-62100743 CTCTGTTCTTACACAGGGACTGG - Intronic
1160475961 18:79188106-79188128 CTGGGCTTTTACATTTGCACCGG - Intronic
1165383407 19:35496192-35496214 CTGTGCTTCTCCACATGGACAGG - Intergenic
1165702518 19:37949338-37949360 CTGTGCATGTACACAGGCACGGG - Intronic
1166370111 19:42295605-42295627 CTGCACTTTGCCACAGGCACGGG + Exonic
925118108 2:1397578-1397600 CTGTGCTTTTCCTCAGACTCAGG - Intronic
925636294 2:5944079-5944101 CTGTTCTTTTAAACAGCCCCAGG + Intergenic
925661591 2:6208888-6208910 CTGTGCTTTAGCAAAGACACTGG + Intergenic
925875172 2:8305236-8305258 CTGTGCTTTCATACAAACACAGG + Intergenic
926396951 2:12453320-12453342 CTGTGCTTCTTCTCAGCCACTGG - Intergenic
927329531 2:21845903-21845925 TTGTGCTTTAACACATGCATTGG + Intergenic
928845554 2:35667376-35667398 CTGTGGTTTTAGACATCCACTGG - Intergenic
933157664 2:78993158-78993180 CTGTCCTTCCACAGAGGCACTGG + Intergenic
933986316 2:87595152-87595174 CTGGGCTGTCACACAGGCAGTGG - Intergenic
936307519 2:111355649-111355671 CTGGGCTGTCACACAGGCAGTGG + Intergenic
937198067 2:120177784-120177806 CTGTGATTGTACAAAGGCAAAGG - Exonic
937521613 2:122719810-122719832 TTGGGCTTTTACAGAGGTACTGG - Intergenic
937839843 2:126513990-126514012 CTGTGCTTATATACAGGCTTAGG - Intergenic
939880281 2:147623553-147623575 CTTTGCTTTTACCCTTGCACAGG + Intergenic
943370807 2:187013581-187013603 CTGTGATTTTTCACAGTCAATGG + Intergenic
943836342 2:192518299-192518321 CTGTGCTTTTGACCAGGCAGTGG + Intergenic
944011547 2:194980105-194980127 CTGTGCTTTAGCAAAGGGACTGG - Intergenic
946397947 2:219452721-219452743 CTGGGATTTTAGACCGGCACGGG + Intronic
947710982 2:232315611-232315633 CTGTGCTTGATGACAGGCACAGG + Intronic
947971515 2:234328976-234328998 CTGTGCTTTCACACAAACAGAGG - Intergenic
948317967 2:237044347-237044369 CCTTTCTTTTACAAAGGCACAGG + Intergenic
1169820477 20:9704195-9704217 CTGTGTTGTAACACAGGCCCAGG - Intronic
1170836620 20:19889842-19889864 TAGTGCTTTCATACAGGCACAGG + Intronic
1172179101 20:32989831-32989853 CTGGGCTTTCACAGAGCCACAGG - Intronic
1173993009 20:47317421-47317443 ATGTGCTGTGACTCAGGCACCGG - Intronic
1174387317 20:50194818-50194840 CTGGGATTTTAAACAGGAACTGG - Intergenic
1176789286 21:13300299-13300321 AAGTGCTATTAGACAGGCACTGG - Intergenic
1177227413 21:18275607-18275629 CTGTGATTTTAAACAGTTACAGG + Intronic
1177988449 21:28008457-28008479 AAGTGCTATTACACAGGCACTGG - Intergenic
1181707497 22:24657805-24657827 CTGTGCTTCTTCCCAGACACGGG + Intergenic
1182437986 22:30342944-30342966 CTGTGCTTTATCACAGGCCCAGG - Intronic
1183390131 22:37540993-37541015 CTGGGCATTTGCACAGGCAGTGG + Intergenic
1184314128 22:43670186-43670208 CTGTGCTTTCATATAGGCTCAGG - Intronic
1203273662 22_KI270734v1_random:73774-73796 CTGTGCTTCTTCCCAGACACGGG - Intergenic
949399652 3:3652556-3652578 CTGTGTCTTTAAACAGACACAGG - Intergenic
949694236 3:6675652-6675674 CCGTGCCTTTACACAGACTCTGG + Intergenic
954687324 3:52377971-52377993 CTGTCTGTTGACACAGGCACTGG - Intronic
955556332 3:60141205-60141227 CTGTGCATTTAGACAGGGAGAGG - Intronic
955835636 3:63051837-63051859 CTTTGCCTTTTCACAGACACAGG - Intergenic
956111287 3:65871930-65871952 CTTTGCTTATAGACAGGAACAGG - Intronic
957841287 3:85673176-85673198 CTGTCCCTATACACAGGCAGAGG - Intronic
958590511 3:96153113-96153135 CTGTGGTTTTAAACATTCACTGG - Intergenic
960025638 3:113006112-113006134 CTGGGATTGTACACAGGCATAGG - Intronic
961097778 3:124172677-124172699 CTGTGCACCTACACAGGCCCAGG - Intronic
962941298 3:140126864-140126886 GTGTGCCTTTACACAGTGACTGG - Intronic
963494051 3:146037855-146037877 CTGTGCTCCTACACAGGCTGAGG - Intergenic
964966240 3:162496746-162496768 CTATGCTTTAGCACAGGGACTGG - Intergenic
965755584 3:172022996-172023018 CTATCCTTTTATACAAGCACTGG - Intergenic
965988442 3:174785977-174785999 CTGTGCCTTTACACAATCACTGG - Intronic
969446385 4:7247006-7247028 CTGTGCCTTTACAGGGGCTCAGG + Intronic
971845724 4:31915839-31915861 CTGTGCTTTTACAAAGAGAATGG + Intergenic
975147604 4:70987080-70987102 CTGTGCGTGTACACACACACTGG + Intronic
978165809 4:105605142-105605164 CTCTGCCTTGACACAGGGACAGG - Intronic
979087132 4:116427708-116427730 CTATGCTTTATCACAGACACTGG + Intergenic
982800045 4:159694656-159694678 ATGTGCTTTTTCTCAGACACTGG - Intergenic
986579773 5:9253086-9253108 CTATGCTATCACACAGGCAATGG + Intronic
987303411 5:16616978-16617000 CTGTGCTTCCAGACAGGGACGGG + Exonic
987708167 5:21481553-21481575 CTGTGCTTCTTCCCAGACACGGG + Intergenic
987708344 5:21482369-21482391 CTGTGCTTCTTCCCAGACACGGG + Intergenic
988696094 5:33623968-33623990 CTGTGGTTGTGCACAGGAACAGG - Intronic
988751611 5:34193402-34193424 CTGTGCTTCTTCCCAGACACGGG - Intergenic
989155240 5:38338640-38338662 CTTTGATCTTACACAAGCACGGG + Intronic
989351948 5:40496707-40496729 CAGTGCTGTTACACTGCCACAGG - Intergenic
991736234 5:69632893-69632915 CTGTGCTTCTTCCCAGACACGGG - Intergenic
991736405 5:69633700-69633722 CTGTGCTTCTTCCCAGACACGGG - Intergenic
991736580 5:69634513-69634535 CTGTGCTTCTTCCCAGACACGGG - Intergenic
991736755 5:69635329-69635351 CTGTGCTTCTTCCCAGACACGGG - Intergenic
991739363 5:69654181-69654203 CTGTGCTTCTTCCCAGACACGGG - Intergenic
991758137 5:69898998-69899020 CTGTGCTTCTTCCCAGACACGGG + Intergenic
991758311 5:69899814-69899836 CTGTGCTTCTTCCCAGACACGGG + Intergenic
991758485 5:69900630-69900652 CTGTGCTTCTTCCCAGACACGGG + Intergenic
991758655 5:69901443-69901465 CTGTGCTTCTTCCCAGACACGGG + Intergenic
991758832 5:69902250-69902272 CTGTGCTTCTTCCCAGACACGGG + Intergenic
991788501 5:70215872-70215894 CTGTGCTTCTTCCCAGACACGGG - Intergenic
991790938 5:70233922-70233944 CTGTGCTTCTTCCCAGACACGGG - Intergenic
991812731 5:70488532-70488554 CTGTGCTTTTTCCCAGACACGGG - Intergenic
991812903 5:70489339-70489361 CTGTGCTTCTTCCCAGACACGGG - Intergenic
991813081 5:70490158-70490180 CTGTGCTTCTTCCCAGACACGGG - Intergenic
991815689 5:70509009-70509031 CTGTGCTTCTTCCCAGACACGGG - Intergenic
991815861 5:70509816-70509838 CTGTGCTTCTTCCCAGACACGGG - Intergenic
991816034 5:70510629-70510651 CTGTGCTTCTTCCCAGACACGGG - Intergenic
991816209 5:70511439-70511461 CTGTGCTTCTTCCCAGACACGGG - Intergenic
991816385 5:70512258-70512280 CTGTGCTTCTTCCCAGACACGGG - Intergenic
991818825 5:70530298-70530320 CTGTGCTTCTTCCCAGACACGGG - Intergenic
991837540 5:70774880-70774902 CTGTGCTTCTTCCCAGACACGGG + Intergenic
991837714 5:70775696-70775718 CTGTGCTTCTTCCCAGACACGGG + Intergenic
991837884 5:70776509-70776531 CTGTGCTTCTTCCCAGACACGGG + Intergenic
991838061 5:70777316-70777338 CTGTGCTTCTTCCCAGACACGGG + Intergenic
991880949 5:71216236-71216258 CTGTGCTTCTTCCCAGACACGGG - Intergenic
991883386 5:71234257-71234279 CTGTGCTTCTTCCCAGACACGGG - Intergenic
993409423 5:87555251-87555273 CTGTGCTTTAGCACAGAGACTGG - Intergenic
994420244 5:99522564-99522586 CTGTGCTTCTTCCCAGACACGGG + Intergenic
994420414 5:99523383-99523405 CTGTGCTTCTTCCCAGACACGGG + Intergenic
994420579 5:99524202-99524224 CTGTGCTTCTTCCCAGACACAGG + Intergenic
994486460 5:100390112-100390134 CTGTGCTTCTTCCCAGACACAGG - Intergenic
994486629 5:100390931-100390953 CTGTGCTTCTTCCCAGACACGGG - Intergenic
994486796 5:100391750-100391772 CTGTGCTTCTTCCCAGACACGGG - Intergenic
994486961 5:100392569-100392591 CTGTGCTTCTTCCCAGACACGGG - Intergenic
994842158 5:104938697-104938719 CTGTGATTTTACACAGGAAAGGG + Intergenic
995120743 5:108533060-108533082 TTGTGCTTTAGCAAAGGCACTGG - Intergenic
995641817 5:114265847-114265869 CTGTGCTCTTTGCCAGGCACTGG + Intergenic
995957285 5:117793101-117793123 CTTTTCTTTTCCACAGGCACAGG + Intergenic
997416520 5:133732709-133732731 CTTTGCTTTTCCACAGGTCCAGG + Intergenic
998000448 5:138620949-138620971 ATGTGCCTTAATACAGGCACTGG - Intronic
998634058 5:143932550-143932572 CTTTCCCTTTACACAGGCAGAGG - Intergenic
1001300270 5:170528489-170528511 CTGTGCTATGCCCCAGGCACTGG - Intronic
1001742838 5:174068065-174068087 TGGTGCTGTTACACAGTCACTGG + Intronic
1002533265 5:179862197-179862219 CTGTGGTTTTAGACATCCACTGG + Exonic
1003868079 6:10381535-10381557 CTGGGCTTTTTCCCAGGCCCAGG + Intergenic
1005549419 6:26898415-26898437 CTGTGCTTCTTCCCAGACACGGG - Intergenic
1005549769 6:26900052-26900074 CTGTGCTTCTTCCCAGACACGGG - Intergenic
1006297232 6:33175126-33175148 CTGAGGTTTTACAGAGGCACAGG - Intronic
1009019983 6:57938708-57938730 CTGTGCTTCTTCCCAGACACGGG - Intergenic
1012384731 6:98666928-98666950 GTGTGCTTATTCCCAGGCACAGG - Intergenic
1015178546 6:130337742-130337764 CTGTGCTTTAACAAAGAGACTGG + Intronic
1016608654 6:145963900-145963922 CTGTGCTTCTCCTCATGCACTGG - Intronic
1018073819 6:160191591-160191613 CTGTGCTATTTCTCAGGCTCTGG - Intronic
1019459515 7:1149477-1149499 CTGTGTTTTGACACAGGCTAGGG + Intergenic
1020546539 7:9540368-9540390 CTATGCTTTAACAAAGGGACAGG + Intergenic
1023635013 7:42200843-42200865 CTGTGTTTTTGCACAGGCTCAGG - Intronic
1023894016 7:44417131-44417153 CTGTGCTTTGTCCCAGGAACTGG - Intronic
1024648186 7:51385828-51385850 CTGTACTTCGACACAGGCAGTGG + Intergenic
1025177385 7:56808869-56808891 CTGCACTTTGACACAGGCAGCGG + Intergenic
1028278960 7:88896784-88896806 CTTTCCTCTTACAAAGGCACTGG - Intronic
1030603939 7:111619194-111619216 CTGTGCTTTCAGAGAGGCAGAGG - Intergenic
1032775604 7:135109724-135109746 CTGCTTTTTCACACAGGCACTGG - Intronic
1035457055 7:159015562-159015584 CTGGGCTCTGACGCAGGCACAGG + Intergenic
1037550394 8:19965294-19965316 CTGTGCTTTTTCTCAGAAACTGG + Exonic
1041465253 8:58151934-58151956 CTGTTTTTTCACACAGGCATCGG - Intronic
1041763889 8:61396696-61396718 CTCTGCTTTTACAGAGATACAGG + Intronic
1045570976 8:103369640-103369662 CTGTGCTGTCACACAGGGCCAGG + Intergenic
1046747793 8:117894683-117894705 CTCTGCTTTTAAACAGGGCCTGG - Intronic
1047881712 8:129201727-129201749 CTTTGCTTTTACAGAGTCAAAGG - Intergenic
1048444235 8:134481404-134481426 ATGAGCTTTAACACAGGCTCTGG + Intronic
1055357419 9:75451710-75451732 CTGGACATTTACAAAGGCACAGG - Intergenic
1055460549 9:76516075-76516097 ATGTGCCTGTACACAGGCAAAGG + Intergenic
1058417328 9:104802538-104802560 CTGGCCTTATACACAGGCTCCGG + Intronic
1059519997 9:114932199-114932221 CTATGCTTTTACAGACTCACTGG - Intergenic
1060342137 9:122787150-122787172 CTGTGATTTCACACATCCACAGG + Intergenic
1060963048 9:127694702-127694724 CTGTGCCTTTCCAGAGGCCCTGG - Intronic
1062062468 9:134503804-134503826 CTATGCCTTCAGACAGGCACTGG + Intergenic
1185953768 X:4466023-4466045 CTGTGTTGTTAAACAGGCATTGG - Intergenic
1188906943 X:35801153-35801175 CTGTGACTTTTCACAGGCCCCGG - Intronic
1189994782 X:46628032-46628054 GTGTGCATATACACAGGCATTGG + Intronic
1191108520 X:56787736-56787758 CTCTGCTTTCACACAGGCAAGGG - Intergenic
1192857944 X:75034015-75034037 GAGTGCTTTTACAAAGCCACAGG - Intergenic
1194132207 X:90095200-90095222 CTGTGCTTTTACAAAGAGACTGG + Intergenic
1197222997 X:123931442-123931464 CTGTGCTTTAACAAAGAGACTGG + Intergenic
1197555515 X:127947602-127947624 CTATGCTTTCAGACTGGCACTGG + Intergenic
1198116837 X:133552311-133552333 CTTTGCTTTGACACAGACACTGG + Intronic
1198449711 X:136754825-136754847 GTGTGCTTTTGCAAAGGCTCTGG - Intronic
1199813195 X:151371154-151371176 CTGTGCTTTTCAGCAGGCCCAGG - Intergenic