ID: 1076356414

View in Genome Browser
Species Human (GRCh38)
Location 10:129856974-129856996
Sequence GGAGCCCTGTGCTTTTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 121}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076356414_1076356425 24 Left 1076356414 10:129856974-129856996 CCTGTGTAAAAGCACAGGGCTCC 0: 1
1: 0
2: 1
3: 6
4: 121
Right 1076356425 10:129857021-129857043 CCAGCAGTGGGGGAAGGGCCTGG No data
1076356414_1076356421 18 Left 1076356414 10:129856974-129856996 CCTGTGTAAAAGCACAGGGCTCC 0: 1
1: 0
2: 1
3: 6
4: 121
Right 1076356421 10:129857015-129857037 CAGAGCCCAGCAGTGGGGGAAGG No data
1076356414_1076356418 12 Left 1076356414 10:129856974-129856996 CCTGTGTAAAAGCACAGGGCTCC 0: 1
1: 0
2: 1
3: 6
4: 121
Right 1076356418 10:129857009-129857031 ACAAGACAGAGCCCAGCAGTGGG No data
1076356414_1076356426 29 Left 1076356414 10:129856974-129856996 CCTGTGTAAAAGCACAGGGCTCC 0: 1
1: 0
2: 1
3: 6
4: 121
Right 1076356426 10:129857026-129857048 AGTGGGGGAAGGGCCTGGTGTGG No data
1076356414_1076356419 13 Left 1076356414 10:129856974-129856996 CCTGTGTAAAAGCACAGGGCTCC 0: 1
1: 0
2: 1
3: 6
4: 121
Right 1076356419 10:129857010-129857032 CAAGACAGAGCCCAGCAGTGGGG No data
1076356414_1076356420 14 Left 1076356414 10:129856974-129856996 CCTGTGTAAAAGCACAGGGCTCC 0: 1
1: 0
2: 1
3: 6
4: 121
Right 1076356420 10:129857011-129857033 AAGACAGAGCCCAGCAGTGGGGG No data
1076356414_1076356427 30 Left 1076356414 10:129856974-129856996 CCTGTGTAAAAGCACAGGGCTCC 0: 1
1: 0
2: 1
3: 6
4: 121
Right 1076356427 10:129857027-129857049 GTGGGGGAAGGGCCTGGTGTGGG No data
1076356414_1076356417 11 Left 1076356414 10:129856974-129856996 CCTGTGTAAAAGCACAGGGCTCC 0: 1
1: 0
2: 1
3: 6
4: 121
Right 1076356417 10:129857008-129857030 AACAAGACAGAGCCCAGCAGTGG No data
1076356414_1076356422 19 Left 1076356414 10:129856974-129856996 CCTGTGTAAAAGCACAGGGCTCC 0: 1
1: 0
2: 1
3: 6
4: 121
Right 1076356422 10:129857016-129857038 AGAGCCCAGCAGTGGGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076356414 Original CRISPR GGAGCCCTGTGCTTTTACAC AGG (reversed) Intronic
902836766 1:19052517-19052539 GGAGCCCCGTGCTGTTGGACTGG - Intergenic
904863412 1:33557671-33557693 GGAGGACTGTTCTTTGACACGGG + Intronic
904991772 1:34598914-34598936 GGAGGGCTGTGCTTTCACATTGG - Intergenic
906843376 1:49163887-49163909 GCAGCCCAGTGCTTTTGCTCGGG - Intronic
906888694 1:49682666-49682688 GGAGCCCTGTGCAGCTGCACAGG - Intronic
906974152 1:50550692-50550714 AAAGCCCTCTGCTTTTACAGGGG + Intronic
907501278 1:54883396-54883418 GGAACCCTTTGCGTTTCCACAGG - Intronic
908456114 1:64306684-64306706 GGAGCCCTGTTCTGTCACCCAGG + Intergenic
911043943 1:93613644-93613666 GGAGCCCTGTTCTGTGCCACTGG + Intronic
914260195 1:145992621-145992643 GGAGCTCAGTGCTCTGACACAGG + Exonic
921324491 1:213977575-213977597 GGAAGCCTGTGCATTAACACGGG - Intergenic
922461006 1:225814447-225814469 GAAGCCCTGAGCTGTGACACTGG - Intronic
922933591 1:229408123-229408145 GGGGCCCTGCGTTTTTGCACGGG - Intergenic
1063882599 10:10546543-10546565 GGTGGCCTGTGCTTTGACTCAGG - Intergenic
1068503746 10:57872399-57872421 GGTGACCTGTGCAGTTACACTGG - Intergenic
1074412397 10:113239696-113239718 GGAGTCCTGTGCTTTAAGAGAGG + Intergenic
1076356414 10:129856974-129856996 GGAGCCCTGTGCTTTTACACAGG - Intronic
1083184204 11:61008032-61008054 GGAACCCGGTGCGTTTGCACTGG - Intronic
1084296596 11:68216280-68216302 GGAGCCTTTGGCATTTACACTGG + Intergenic
1084602882 11:70156767-70156789 GGAACCCTATGCGTTTGCACTGG + Intronic
1085722738 11:78927665-78927687 AGAGCCCTTTGCCTTAACACAGG - Intronic
1088704867 11:112453136-112453158 GAAGCCTTGTGTATTTACACAGG - Intergenic
1091359958 11:134971325-134971347 GGAGCCATGTGTTTTCACAGAGG - Intergenic
1092045265 12:5427851-5427873 GTAGCCATGTGCTTTTGTACAGG - Intergenic
1094108678 12:26838709-26838731 GGGGCCCTGTGCTATTGCACAGG - Intergenic
1096475073 12:51904559-51904581 GGGGCCCTGTGCATCTGCACAGG + Intergenic
1100120063 12:91359317-91359339 GGAGCCCTGGGCTTTATCTCTGG - Intergenic
1100990886 12:100250239-100250261 GGAGTCTTGTGCTGTTACCCAGG + Intronic
1101867237 12:108529182-108529204 GGAACCCTGTGGTGTTAGACCGG + Intronic
1101961573 12:109254736-109254758 GGAACTCTGTGAGTTTACACAGG + Intronic
1103556796 12:121771297-121771319 GGACCCCTGTGCTTCTAGAAAGG + Intronic
1103570317 12:121840324-121840346 GGAGCCTTGCGCTGTTACCCAGG + Intronic
1103896504 12:124277129-124277151 GGTGTCCTGTGCTTTTACCTGGG + Intronic
1106324269 13:28673094-28673116 GGAGTCTTGTGCTGTTACCCGGG + Intronic
1114036984 14:18638493-18638515 GAAGCCCTTTTCTTCTACACTGG - Intergenic
1120095936 14:80387686-80387708 GCAGCTCTGTCCTTTTAAACTGG + Intronic
1121052536 14:90828810-90828832 GGAGCCCTGGGCTGTGACCCAGG - Intergenic
1126328465 15:47507080-47507102 GGAGCCATGTGCATTTCCCCAGG + Intronic
1128528508 15:68428709-68428731 CTAGCACTGTGCTTTTCCACAGG + Intronic
1133113952 16:3565283-3565305 GGGGCCCTGAGCTTGTACCCCGG + Intronic
1133431683 16:5742414-5742436 TGAGCCCAGTGCTTTTATAGCGG + Intergenic
1133984774 16:10660232-10660254 AGAGCCCTTTTCTATTACACAGG - Intronic
1137400121 16:48146439-48146461 GGAGCCCTGGGCTTTTGGCCTGG + Exonic
1140271899 16:73473546-73473568 GGAGCCCTGTGATTCTACTCTGG - Intergenic
1140325712 16:74000503-74000525 GGTTCCCTGTGCTGTTCCACTGG + Intergenic
1144933043 17:18875537-18875559 GGAGCCTTGTTCTTTTACCCAGG - Intronic
1146554858 17:33814574-33814596 GCAGCACTGTGCTTCTACATTGG + Intronic
1146592558 17:34140318-34140340 TGAACCCTGTGCTGTTAGACTGG + Intronic
1151668248 17:75557797-75557819 GGTGCCGTGTGTTTTTTCACAGG + Intronic
1152325829 17:79635388-79635410 GGAGCCCTGTCCTGTTACATAGG + Intergenic
1153555735 18:6311316-6311338 GGAGACCTTTTCTTTTACAAAGG - Intronic
1153659745 18:7316317-7316339 GGAGTCTTGTGCTATTACCCAGG - Intergenic
1153938945 18:9960136-9960158 GGAGACATGTTCTTGTACACTGG + Intergenic
1154062102 18:11071778-11071800 GGAGGCCTCTGCTTGCACACTGG - Intronic
1154495154 18:14950684-14950706 GGAGCCATGTGTTTTCACAGAGG + Intergenic
1155933258 18:31728285-31728307 GGAGCCCTGTGCAGTTAAAGAGG - Intergenic
1157898231 18:51488754-51488776 GGAAGCCTGTGCTTAAACACAGG + Intergenic
1167592127 19:50409712-50409734 GGAGCCCTGGTCTCCTACACAGG - Intronic
1168635547 19:57993632-57993654 GCAGCCATGTACTTATACACGGG + Intronic
928209438 2:29312628-29312650 GGAGCCCTGTGCTTTCTGATAGG + Intronic
930703349 2:54481669-54481691 TGAAACCTGTGCTTTTTCACTGG - Intronic
930874287 2:56196588-56196610 GCAGGCCTTTGCTTTTAAACAGG + Intronic
933139123 2:78771601-78771623 CCAGCCCCGTGCTTTTGCACAGG + Intergenic
937872905 2:126798661-126798683 AGAGCCCTGTGCTTTAAGTCTGG - Intergenic
938441561 2:131339334-131339356 GAAGCCCTTTTCTTCTACACTGG - Intronic
939001778 2:136745023-136745045 AGATGCCTGTGCTTTCACACTGG + Intergenic
941499807 2:166259235-166259257 GCAGCTCTGTGCTTTTAACCAGG - Intronic
945181618 2:207097484-207097506 GAAGCCCTGTGCCTTTGCCCTGG - Intronic
1178294135 21:31394787-31394809 GGAGCCCTGTGTGTTTGCCCTGG - Intronic
1179510193 21:41867481-41867503 GGAGCGCAGTGGTTTTTCACAGG + Intronic
1179654526 21:42837199-42837221 GGAGGCCTGGGCTTCTGCACTGG + Intergenic
1180461108 22:15565541-15565563 GAAGCCCTTTTCTTCTACACTGG - Intergenic
1180882563 22:19216675-19216697 GGAGCCACGTGCCTTCACACCGG + Intronic
1181046152 22:20215272-20215294 GGATCCCTGAGATCTTACACAGG + Intergenic
1181363076 22:22353811-22353833 GGAGGTCTCTGCTTGTACACTGG - Intergenic
950437826 3:12991329-12991351 GGAGCCCCCTGCCTTTCCACTGG - Intronic
952813104 3:37422686-37422708 AGAGCCCTGTGGTTTTCCAGGGG + Intronic
953589528 3:44238095-44238117 GGAACCCTGTGCAGCTACACAGG - Intergenic
960810965 3:121627266-121627288 ACAGGCCTGTGCTTTTACATGGG + Exonic
960922380 3:122760642-122760664 TGAGCCATGTGCATTTACAGTGG - Intronic
961201554 3:125049587-125049609 GGAGCTCTTTGCTTTTAAAGGGG - Intronic
962282303 3:134061167-134061189 GGAGCCCTTTGCCCTCACACGGG + Intergenic
965422581 3:168480446-168480468 GGACCCTTGTGCTATTACATTGG + Intergenic
966296822 3:178433355-178433377 GAAGCCCTGTAATATTACACAGG + Intronic
969929729 4:10619320-10619342 GGAGCTTTGTGTTTTTAAACCGG + Intronic
975351726 4:73354920-73354942 AGAGCCCTCTGCTGTTGCACAGG + Intergenic
978712177 4:111797396-111797418 GGAGCCCTGTGTGACTACACTGG + Intergenic
979388018 4:120092944-120092966 GGAGTCTTGTGCTGTTACCCAGG + Intergenic
980377308 4:131967024-131967046 GGAGCCTTGTTCTTTCACCCAGG + Intergenic
984743064 4:183186312-183186334 TGAGCCATGTGCTTTTTCAAAGG + Intronic
992373352 5:76168066-76168088 GGAGACTTGTGCATTTATACAGG - Intronic
994180508 5:96758729-96758751 GCAGCACGGTGCTTTTACAGGGG - Intronic
994322376 5:98408173-98408195 GGGGCCCTGTGCAACTACACAGG + Intergenic
999345008 5:150810067-150810089 TGAGCCCTGTGCTGTTAGATTGG - Intergenic
1001684308 5:173581930-173581952 GGAGCCCTGGGCTTTGACTCTGG + Intergenic
1002357459 5:178642312-178642334 GGAGCCCTCTGCTGTGACACAGG - Intergenic
1002524696 5:179808323-179808345 GGAGCCCTCTCCTTTAACAGGGG - Intronic
1007725571 6:43913786-43913808 GGAGCCACGTGTTTTTCCACTGG + Intergenic
1007727948 6:43928055-43928077 GCAGCCCTATTCTTGTACACAGG + Intergenic
1011027435 6:82884709-82884731 GGAACACTGAGATTTTACACTGG + Intergenic
1011135460 6:84095167-84095189 GGAACCCTGTGTTTTGACAATGG + Intergenic
1012434241 6:99198030-99198052 GGAGCCCCGTGCAACTACACAGG + Intergenic
1013598479 6:111682726-111682748 GTATCCCTGTGCTTGCACACTGG + Intronic
1016370833 6:143372306-143372328 GGAGTGCTGTTGTTTTACACAGG - Intergenic
1017851028 6:158306201-158306223 GGAACACTGTGCTTTTACTGTGG + Intronic
1019459511 7:1149471-1149493 GGAGCCCTGTGTTTTGACACAGG + Intergenic
1020850062 7:13341752-13341774 GGTTCTCTGTACTTTTACACTGG + Intergenic
1029298764 7:99561983-99562005 GGAACCCTCTGCTTTTCCTCAGG + Intronic
1029595113 7:101533559-101533581 GGAGTCCTGTTCTTATAGACTGG - Intronic
1031312582 7:120217065-120217087 TGATCCCTGTGATTTTACAGAGG - Intergenic
1032350642 7:131159965-131159987 TGAGACCTGGGCTTTCACACAGG + Intronic
1033922887 7:146416674-146416696 GGAGCTCTGTGGTTTTCCTCTGG + Intronic
1034033811 7:147799032-147799054 GAAGGCCTGGGGTTTTACACTGG - Intronic
1034746633 7:153529227-153529249 GGACCCCTGTGAGTTCACACAGG + Intergenic
1036441698 8:8787669-8787691 TGAGACGTGTGTTTTTACACTGG - Intronic
1037203932 8:16291432-16291454 GGAGCCCTGTCCGATTGCACTGG + Intronic
1037670986 8:21015152-21015174 GGAGCCCTGGAATTATACACTGG - Intergenic
1039697468 8:39927974-39927996 GGAGACCAGAGCTTTCACACAGG - Exonic
1041169399 8:55125914-55125936 TGAGCCCTGTGTTACTACACAGG + Intronic
1044049974 8:87488959-87488981 AAAGCCCTGTGCTATTGCACAGG - Intronic
1044381995 8:91545013-91545035 GGAGCACTGTGTTTTCACTCTGG - Intergenic
1050417195 9:5429991-5430013 GGAGCCTACTGCTTTTACAGTGG - Intronic
1055231172 9:74067545-74067567 GGAGCCCTGTCTTCTTCCACAGG - Intergenic
1057564809 9:96158285-96158307 GGAGGCCTGTGCCTGTCCACAGG - Intergenic
1058787632 9:108405803-108405825 GGAGTCTTGTGCTTTCACCCAGG - Intergenic
1060414496 9:123420896-123420918 GGAGCCCTTTGTTTTTAGTCGGG + Intronic
1061003668 9:127916584-127916606 GGTGCCATGTGCTTTCACCCCGG - Intronic
1062053372 9:134458464-134458486 GGGGCCCTGGGGTTTGACACTGG + Intergenic
1197833202 X:130667417-130667439 GGAGCCTTGAGCCTTAACACAGG + Intronic