ID: 1076356416

View in Genome Browser
Species Human (GRCh38)
Location 10:129856995-129857017
Sequence CTGTCTTGTTCACACCTGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 164}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076356416_1076356427 9 Left 1076356416 10:129856995-129857017 CCGCACAGGTGTGAACAAGACAG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1076356427 10:129857027-129857049 GTGGGGGAAGGGCCTGGTGTGGG No data
1076356416_1076356430 28 Left 1076356416 10:129856995-129857017 CCGCACAGGTGTGAACAAGACAG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1076356430 10:129857046-129857068 TGGGGAATCGATTCCCATTCAGG No data
1076356416_1076356417 -10 Left 1076356416 10:129856995-129857017 CCGCACAGGTGTGAACAAGACAG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1076356417 10:129857008-129857030 AACAAGACAGAGCCCAGCAGTGG No data
1076356416_1076356428 10 Left 1076356416 10:129856995-129857017 CCGCACAGGTGTGAACAAGACAG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1076356428 10:129857028-129857050 TGGGGGAAGGGCCTGGTGTGGGG No data
1076356416_1076356426 8 Left 1076356416 10:129856995-129857017 CCGCACAGGTGTGAACAAGACAG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1076356426 10:129857026-129857048 AGTGGGGGAAGGGCCTGGTGTGG No data
1076356416_1076356431 29 Left 1076356416 10:129856995-129857017 CCGCACAGGTGTGAACAAGACAG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1076356431 10:129857047-129857069 GGGGAATCGATTCCCATTCAGGG No data
1076356416_1076356419 -8 Left 1076356416 10:129856995-129857017 CCGCACAGGTGTGAACAAGACAG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1076356419 10:129857010-129857032 CAAGACAGAGCCCAGCAGTGGGG No data
1076356416_1076356420 -7 Left 1076356416 10:129856995-129857017 CCGCACAGGTGTGAACAAGACAG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1076356420 10:129857011-129857033 AAGACAGAGCCCAGCAGTGGGGG No data
1076356416_1076356418 -9 Left 1076356416 10:129856995-129857017 CCGCACAGGTGTGAACAAGACAG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1076356418 10:129857009-129857031 ACAAGACAGAGCCCAGCAGTGGG No data
1076356416_1076356425 3 Left 1076356416 10:129856995-129857017 CCGCACAGGTGTGAACAAGACAG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1076356425 10:129857021-129857043 CCAGCAGTGGGGGAAGGGCCTGG No data
1076356416_1076356422 -2 Left 1076356416 10:129856995-129857017 CCGCACAGGTGTGAACAAGACAG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1076356422 10:129857016-129857038 AGAGCCCAGCAGTGGGGGAAGGG No data
1076356416_1076356421 -3 Left 1076356416 10:129856995-129857017 CCGCACAGGTGTGAACAAGACAG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1076356421 10:129857015-129857037 CAGAGCCCAGCAGTGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076356416 Original CRISPR CTGTCTTGTTCACACCTGTG CGG (reversed) Intronic
900089659 1:914367-914389 CTGTCGTGAGCACACCAGTGGGG + Intergenic
900494946 1:2972084-2972106 CCTTGTTTTTCACACCTGTGTGG + Intergenic
901446872 1:9313869-9313891 TTGTCTTGTTCACTCCTATAGGG - Intronic
902262879 1:15239995-15240017 CTCTGGTGTTCACACCTCTGTGG + Intergenic
902309860 1:15573831-15573853 CTGTCTTGTGCACCCCTCTAGGG + Intronic
902332850 1:15739090-15739112 TTGTATTGGACACACCTGTGAGG - Intronic
903612412 1:24625597-24625619 CTGTCTTTTTCTCATCTGTTTGG + Intergenic
903725316 1:25438415-25438437 CTGCCTATTTCACACTTGTGAGG - Intronic
904277637 1:29394768-29394790 CTGTATTGAGCACCCCTGTGCGG + Intergenic
906091535 1:43183713-43183735 CTATCTAGCTCACACCTGGGTGG + Exonic
906166035 1:43687066-43687088 CTATCTTGGTCACTCCTGTTTGG + Intronic
911057433 1:93720822-93720844 GTGTCTTTTTCTCACTTGTGGGG + Intronic
912247465 1:107975128-107975150 CTATCTTGATCACACTTATGAGG + Intergenic
917218796 1:172705672-172705694 CTGTTTTGTTCTCCTCTGTGTGG + Intergenic
917269155 1:173254558-173254580 TTGGCTTGTTCTCACCTGTTGGG + Intergenic
921587552 1:216965720-216965742 GTGCCTTGTGCACACCTGTATGG - Intronic
922416274 1:225426277-225426299 CTGGCTATTTCACTCCTGTGGGG - Intronic
922791907 1:228315580-228315602 TAGTCTTGTGAACACCTGTGAGG + Intronic
923567773 1:235089590-235089612 GTGTCTTGCTGAAACCTGTGCGG + Intergenic
924919549 1:248613238-248613260 CTGGTTTGTTCTCATCTGTGTGG + Intergenic
1063176254 10:3553182-3553204 CTACCTTGTCCACACCTCTGAGG + Intergenic
1063331989 10:5168823-5168845 CTTTCTTTTTCACACCTCTATGG - Intergenic
1068378194 10:56212544-56212566 CTGTTTTTTTCTCATCTGTGTGG + Intergenic
1070269140 10:74934977-74934999 CTGCTTTCTTCACCCCTGTGTGG - Intronic
1071931382 10:90474952-90474974 CTGTCTTGTTCCCACTTGTAGGG + Intergenic
1074883999 10:117680574-117680596 CTGTCTGCTTCATGCCTGTGTGG - Intergenic
1075040389 10:119103518-119103540 CTGTCTTGTTCAGCCCTATAAGG + Intergenic
1075593553 10:123710389-123710411 CTGTCTGGTTCACTCCCGAGTGG - Intronic
1076082828 10:127599023-127599045 CTGTGTTGTTCTCACCTCTCAGG - Intergenic
1076291181 10:129347032-129347054 CTGCATAGTTCAAACCTGTGTGG - Intergenic
1076356416 10:129856995-129857017 CTGTCTTGTTCACACCTGTGCGG - Intronic
1083694777 11:64435363-64435385 CTGTCTTGTACACTGCTGGGTGG + Intergenic
1084427029 11:69089787-69089809 CTTCCTTGCTCCCACCTGTGTGG + Intronic
1085463361 11:76708389-76708411 CAGTGTCGTTCACACCTGTGGGG - Intergenic
1088684757 11:112275276-112275298 CCTTCTTGGTCACACCTCTGGGG + Intergenic
1092611336 12:10176374-10176396 CTATTTTGTTCAAACCTGTTTGG + Intronic
1096805141 12:54136027-54136049 CTTTCCTGTTCACAGCTGGGAGG + Intergenic
1098651037 12:72969361-72969383 CTGACTAGTTCTCACCAGTGTGG + Intergenic
1098748101 12:74265571-74265593 CTGTCTTCTTAACCACTGTGGGG - Intergenic
1103130932 12:118467845-118467867 CTGCCTTGCTCACACATATGTGG - Intergenic
1103179991 12:118902492-118902514 ATGTTTTGTTCACATCGGTGTGG - Intergenic
1103348694 12:120267804-120267826 CTTTCTTTTTCAAAGCTGTGTGG + Intergenic
1107988085 13:45793140-45793162 CAGTGTTGTTCACACCGTTGTGG + Intronic
1109557148 13:63991965-63991987 CTGTCTTGTAAAAACATGTGAGG + Intergenic
1113261485 13:108569256-108569278 CTGCCTTCTTCACACTTTTGAGG + Intergenic
1113782839 13:112986522-112986544 CTGTCTTAAACACCCCTGTGCGG - Intronic
1119192161 14:72690125-72690147 GTGGCTTGTTCTCACCTCTGTGG - Intronic
1121024839 14:90608100-90608122 CTGTCATTCACACACCTGTGTGG - Intronic
1122418742 14:101562609-101562631 CTGTCTCATTCACACCTGCCTGG + Exonic
1122523966 14:102366957-102366979 CTGGCTTCTTCTCAACTGTGGGG - Intronic
1126096858 15:45096131-45096153 CTGTCCTCTTCACACCCCTGAGG + Intronic
1128185022 15:65637620-65637642 CTGTTTTATTCACCACTGTGTGG - Intronic
1128237620 15:66078685-66078707 AGGTCCTTTTCACACCTGTGTGG + Intronic
1129326485 15:74802668-74802690 CTCTCTTGGACCCACCTGTGGGG + Exonic
1129545656 15:76392370-76392392 CTGTCATGTCCAACCCTGTGAGG + Intronic
1130087528 15:80790498-80790520 ATGTCTTGTTCACAGTTGTCAGG - Intronic
1132654533 16:1036376-1036398 ATGTCTTGTTCAGCCCCGTGGGG - Intergenic
1133100473 16:3476214-3476236 CTCTGTCATTCACACCTGTGGGG - Exonic
1137696547 16:50465715-50465737 CTGGCTTGTGGTCACCTGTGGGG - Intergenic
1138096897 16:54218988-54219010 CTGCCTTTTGCTCACCTGTGGGG + Intergenic
1140487519 16:75305419-75305441 CTGCCTTCTTCAGACCTCTGTGG + Intronic
1140666772 16:77235038-77235060 CAGCTTTTTTCACACCTGTGTGG + Intergenic
1141047421 16:80727985-80728007 CTGTTTTTTTCCCACCTTTGTGG - Intronic
1141057176 16:80829158-80829180 CTGTCTTCTTCCCACTTTTGAGG + Intergenic
1141214738 16:82012454-82012476 CTGTCTTGTCCTCACCTATTAGG + Intergenic
1141421234 16:83917893-83917915 CTGTCTGGTTCTCTCCTGTGTGG + Exonic
1150000752 17:61437956-61437978 CTCTCTTGTTCCCCCTTGTGGGG + Intergenic
1150293033 17:63992830-63992852 GTGTCTCCTTCACACATGTGTGG + Intergenic
1153761764 18:8338457-8338479 CTGTGTGGTACACACCTGTCTGG + Intronic
1155668985 18:28346659-28346681 CTGATTTTTTCAAACCTGTGAGG - Intergenic
1159574417 18:70157506-70157528 CTGTTTTTTTCTTACCTGTGTGG - Intronic
1160179103 18:76618998-76619020 CTGCCTTGTTCACAACAGTTGGG + Intergenic
1160397860 18:78585007-78585029 CTGTCACCTTCACATCTGTGGGG + Intergenic
1161809401 19:6463416-6463438 CTGTATGGTAAACACCTGTGTGG - Intronic
1163825646 19:19523011-19523033 CTGTCTTGTACACACAGCTGTGG + Intronic
1163825823 19:19524338-19524360 CTGTCTTGTACACACAGCTGTGG + Intronic
1166304674 19:41931006-41931028 CTGTAATGTTAACACCTTTGAGG + Intergenic
1166531288 19:43545036-43545058 CTTTCTTGTTCTGACCTTTGGGG + Intronic
925271985 2:2616555-2616577 CTGCATTGTTCCCACCTTTGTGG - Intergenic
926054503 2:9766457-9766479 CTGACTTGTTCACACCTCCCAGG + Intergenic
928056857 2:28065182-28065204 CTGACTTGTTCATAAGTGTGAGG + Intronic
929326508 2:40618093-40618115 CTCTCTTGCTCAAACCTCTGAGG - Intergenic
929601986 2:43210318-43210340 CTCACCTGTTCACACCTGTACGG - Intergenic
931501681 2:62875530-62875552 CTGGCTTTTTCTCATCTGTGTGG - Intronic
935300128 2:101686601-101686623 CTGCCTTGCTCATACCTGTCTGG + Intergenic
935677861 2:105611142-105611164 CTTTCCTCTTCACACCTGTGAGG + Intergenic
937462102 2:122098336-122098358 ATTTCTTGCTCACTCCTGTGTGG - Intergenic
943472354 2:188310250-188310272 CTGTCTTGCTCAAAGCTGTGAGG - Intronic
944555156 2:200880851-200880873 CTGTGTTTTTCAAACCTCTGTGG - Intronic
947237734 2:227961073-227961095 GTGTTTTATTCACACTTGTGTGG - Intergenic
947897225 2:233686891-233686913 CTTTCTTGTTGACCCCTCTGGGG - Intronic
1169447495 20:5684685-5684707 CTGTATTGGTCACATCTATGAGG + Intergenic
1169778033 20:9277302-9277324 CTGTTTTGTTCAGGCCTGTTTGG - Intronic
1170662034 20:18351429-18351451 CTTTCTTTTTCTCACCAGTGTGG - Intergenic
1171038194 20:21733913-21733935 CTGTCTTTTTCCCCTCTGTGGGG + Intergenic
1172923496 20:38508955-38508977 ATGTCTTGTTCACGTATGTGAGG + Intronic
1173021556 20:39271838-39271860 TTGTTGTGTCCACACCTGTGAGG - Intergenic
1173820600 20:46017577-46017599 TTGTCTTGTGCACACATGTGAGG - Intergenic
1175720436 20:61282661-61282683 GTGCCTTGTGCACACGTGTGTGG + Intronic
1177155109 21:17493627-17493649 CTCTCTCCTTCACACCTCTGAGG + Intergenic
1179792303 21:43762653-43762675 CTGGCTCCTTCACACCTGGGTGG + Intergenic
1182738441 22:32547994-32548016 ATGACTTGTGCACACCTGGGTGG - Intronic
1183163995 22:36133721-36133743 TTGACTGGATCACACCTGTGAGG + Intergenic
1185138410 22:49086882-49086904 CTGACTGGCTCACACATGTGTGG - Intergenic
950432331 3:12958082-12958104 CTGTCATGTTCTTACCTCTGTGG + Intronic
951886179 3:27526715-27526737 CTCTCTTGCTTAAACCTGTGGGG - Intergenic
952483836 3:33789500-33789522 CAGACTTCTTCACACATGTGAGG - Intergenic
953686044 3:45079226-45079248 GAGTCCTGTTCACATCTGTGTGG - Intergenic
955046399 3:55364531-55364553 CTGTGTTTTTCATACCTCTGAGG - Intergenic
959835044 3:110908528-110908550 CTGTCTTGTTCAGAAATGTATGG + Intergenic
960124299 3:113981377-113981399 CTTTCTTGGTCACACCCCTGAGG - Intronic
963139421 3:141935347-141935369 CTGTCTTGCTCCCTCCTATGAGG - Intergenic
963532779 3:146491935-146491957 CTGTCTTTTCCTCATCTGTGTGG + Intronic
963919852 3:150894905-150894927 CTGTCTTGTACATAGCTGTGGGG - Intronic
964051181 3:152395811-152395833 CGGGAATGTTCACACCTGTGTGG + Intronic
964528510 3:157642094-157642116 CTTCCCTGTTCACACATGTGGGG - Intronic
966923694 3:184630792-184630814 GTGTCTTGTTCCCACCTAAGGGG + Intronic
968728720 4:2259984-2260006 CTGACTTGTCCCCACCTGTGAGG - Intronic
977294267 4:95193667-95193689 CTGTCTCTGTCACAGCTGTGGGG + Intronic
978188952 4:105891469-105891491 CTGTCTTCTTCAGCCCTGAGAGG - Intronic
979663634 4:123287010-123287032 ATGTCTGGTTCAAAGCTGTGAGG - Intronic
983172464 4:164551702-164551724 CTTGCTTGTTCCCTCCTGTGAGG - Intergenic
984456730 4:179978391-179978413 CTGTCTTGTTCACAAAGGGGAGG + Intergenic
986158773 5:5204110-5204132 ATGTCTTGTTCACGCATGTCTGG + Intronic
989679792 5:44014812-44014834 CTGTTTTTTTCCCATCTGTGTGG - Intergenic
992029867 5:72710381-72710403 CTGTCTTGCTCACATCTGAATGG + Intergenic
992343289 5:75848642-75848664 CTGTTTAGTTCATACCTGTGTGG + Intergenic
992650570 5:78855445-78855467 CTGTTTTGTGCTCCCCTGTGGGG - Intronic
993099573 5:83520789-83520811 CTGCCTTACTCACAACTGTGGGG + Exonic
994120718 5:96109677-96109699 GTATCTTCTGCACACCTGTGTGG + Intergenic
994617925 5:102129434-102129456 CTTTTTTGTACACACCTGAGAGG - Intergenic
995675406 5:114657632-114657654 CTGTGTGGTTCACAGCTCTGTGG - Intergenic
997008953 5:129853908-129853930 TTTTCTTGTTCACATCTGAGAGG - Intergenic
997365180 5:133321121-133321143 CTCTCTTGTAGTCACCTGTGTGG - Intronic
997538564 5:134642043-134642065 GTGTCTTATTCACACAAGTGTGG - Intronic
997702432 5:135912142-135912164 CTTCCTTGTTCCCACCTCTGAGG + Intergenic
1000521407 5:162299516-162299538 CTGGTTTTTTCTCACCTGTGTGG + Intergenic
1004830481 6:19472296-19472318 CTGTCTTTTGCACACATCTGTGG + Intergenic
1007790902 6:44307537-44307559 CTGGCTTGTGCTCATCTGTGAGG - Exonic
1008090683 6:47290843-47290865 CTGTCTTGCACACACCTATTAGG - Intronic
1010031142 6:71271534-71271556 CTGTTTTTTTCCCACCTTTGTGG - Intergenic
1010916411 6:81624266-81624288 TTGACTTTTTCACTCCTGTGAGG + Intronic
1011617278 6:89208731-89208753 CTGTCTGGATCACACATTTGTGG - Intronic
1011711122 6:90055008-90055030 CTGTTTTTTTCACATCTTTGTGG - Intronic
1016237733 6:141888126-141888148 CTGTTTTTTTCTCATCTGTGTGG - Intergenic
1018906815 6:168080323-168080345 CTGTCTTGGGCACACATGTGTGG - Intronic
1019118727 6:169786343-169786365 CTGTCTTGTTCTCATCTGGCAGG - Intergenic
1020768205 7:12352687-12352709 CTGTGTTGCTCATATCTGTGGGG + Intronic
1023835526 7:44065226-44065248 CTGCCTTGTTGAGGCCTGTGAGG + Exonic
1025174951 7:56794601-56794623 CTGTCTTGATCAGACATATGAGG + Intergenic
1025696852 7:63781814-63781836 CTGTCTTGATCAGACATATGAGG - Intergenic
1026391409 7:69906353-69906375 CTGTCATGTACAGACTTGTGTGG - Intronic
1026603950 7:71800086-71800108 CTGTCAGGTTCACACCTGGATGG - Intronic
1030609609 7:111674501-111674523 CTGTCTGCTTCATACCTATGTGG - Intergenic
1033269339 7:139916595-139916617 CTGCAATGTTCACAGCTGTGTGG - Intronic
1035662036 8:1355717-1355739 CAGTCTTGTTCAGAGCTCTGTGG - Intergenic
1035675400 8:1452319-1452341 CTGTCCTGTGCACACCTGTATGG - Intergenic
1036786071 8:11688180-11688202 CTGTTTTGATCTCACGTGTGTGG - Intronic
1036991314 8:13599165-13599187 TTGTCTTATTCACACATGTCAGG - Intergenic
1039333817 8:36568084-36568106 ATTTCTGGTTCACAACTGTGTGG - Intergenic
1041224719 8:55686967-55686989 CTGTCTTGTTTAAACCTTTTTGG - Intergenic
1042751107 8:72158544-72158566 CTCTCTTTTTCATACCTCTGGGG + Intergenic
1046212268 8:111092304-111092326 CTGGCTTGTTCTCACCTTTCTGG + Intergenic
1048227524 8:132603066-132603088 TTGTTTTCTTCCCACCTGTGTGG + Intronic
1048610218 8:136014428-136014450 CTGACTTGTTCACACCTCTTTGG + Intergenic
1050173236 9:2844044-2844066 CTGTCTCGGTCCCACGTGTGCGG - Exonic
1052022059 9:23537175-23537197 CTGTCTTGTTCAGTTCTTTGTGG - Intergenic
1053509388 9:38674630-38674652 CTGTCTTGTTCTCAACTTAGGGG - Intergenic
1061577225 9:131514570-131514592 TTGTCTTGTTCACAGCTGGGTGG + Intronic
1187830161 X:23373042-23373064 CTGTCTTATCCATACCAGTGTGG + Intronic
1187923816 X:24232260-24232282 GTGTCTTGTTTTCACCTCTGGGG + Intergenic
1188442405 X:30225484-30225506 CTGTATTGTTTACATGTGTGTGG + Intergenic
1188590923 X:31834257-31834279 GTGTCATGTTCAAAACTGTGAGG + Intronic
1191036531 X:56030890-56030912 CTGTCCTGTTAACCACTGTGGGG + Intergenic
1193229875 X:79031693-79031715 CTGTTTTTTTCCCACCTTTGTGG + Intergenic
1198631621 X:138645228-138645250 CTGTGATTTTCTCACCTGTGAGG - Intronic
1199291879 X:146113918-146113940 CTGACTTGTGCACACCACTGGGG - Intergenic
1199400283 X:147390494-147390516 CTGTTTTTTTCTCATCTGTGTGG - Intergenic