ID: 1076356421

View in Genome Browser
Species Human (GRCh38)
Location 10:129857015-129857037
Sequence CAGAGCCCAGCAGTGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076356411_1076356421 24 Left 1076356411 10:129856968-129856990 CCAGTGCCTGTGTAAAAGCACAG 0: 1
1: 0
2: 2
3: 15
4: 215
Right 1076356421 10:129857015-129857037 CAGAGCCCAGCAGTGGGGGAAGG No data
1076356414_1076356421 18 Left 1076356414 10:129856974-129856996 CCTGTGTAAAAGCACAGGGCTCC 0: 1
1: 0
2: 1
3: 6
4: 121
Right 1076356421 10:129857015-129857037 CAGAGCCCAGCAGTGGGGGAAGG No data
1076356416_1076356421 -3 Left 1076356416 10:129856995-129857017 CCGCACAGGTGTGAACAAGACAG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1076356421 10:129857015-129857037 CAGAGCCCAGCAGTGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076356421 Original CRISPR CAGAGCCCAGCAGTGGGGGA AGG Intronic
No off target data available for this crispr