ID: 1076356880

View in Genome Browser
Species Human (GRCh38)
Location 10:129859723-129859745
Sequence CCAGCGTGTGCCCCGCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076356880_1076356885 23 Left 1076356880 10:129859723-129859745 CCAGCTGGCGGGGCACACGCTGG 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1076356885 10:129859769-129859791 CAGCCATGGGCTGTTAGCACTGG No data
1076356880_1076356882 9 Left 1076356880 10:129859723-129859745 CCAGCTGGCGGGGCACACGCTGG 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1076356882 10:129859755-129859777 TAGTCTATCGATTCCAGCCATGG No data
1076356880_1076356883 10 Left 1076356880 10:129859723-129859745 CCAGCTGGCGGGGCACACGCTGG 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1076356883 10:129859756-129859778 AGTCTATCGATTCCAGCCATGGG No data
1076356880_1076356886 24 Left 1076356880 10:129859723-129859745 CCAGCTGGCGGGGCACACGCTGG 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1076356886 10:129859770-129859792 AGCCATGGGCTGTTAGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076356880 Original CRISPR CCAGCGTGTGCCCCGCCAGC TGG (reversed) Intronic
900129754 1:1082395-1082417 CCAGCCGGTGCCCGGCCAGTGGG - Exonic
900579743 1:3403134-3403156 CCAGGGTGTGTCCCACCAGGGGG - Intronic
901027864 1:6288486-6288508 TCAGCTTGAGCCCCTCCAGCTGG - Intronic
901425705 1:9181413-9181435 CCAGCCTGTGAGCCGCCAGTGGG - Intergenic
904882671 1:33712474-33712496 CCAGCCTGAGCCTCGGCAGCAGG + Intronic
905626891 1:39495262-39495284 CCAGCGAGAGCCCCGCCCTCTGG - Intronic
905734616 1:40316805-40316827 CCATTGTATGCCCCGCCACCTGG + Intronic
906962661 1:50427845-50427867 CCAGCGGGTTCCCGGCCAACGGG - Intergenic
910432052 1:87168416-87168438 CCAGAGTGTGCCCCACCTGGTGG - Exonic
920434696 1:205940252-205940274 CCAGCCTGTGCCCTCCCTGCAGG - Intronic
922472813 1:225887415-225887437 CCAGGGTGTGCAGCTCCAGCTGG + Exonic
922480825 1:225939377-225939399 CCAGGGTGTGCAGCTCCAGCTGG + Exonic
922741338 1:228015889-228015911 CAAGCGTGGCCCCAGCCAGCAGG - Intronic
924385004 1:243492037-243492059 CCAGCCTGAGCCCCACCACCAGG - Intronic
1064267898 10:13839816-13839838 CCGGCGTGTGCTGCCCCAGCTGG + Intronic
1066026513 10:31363934-31363956 GCAGGGTGAGCCCGGCCAGCTGG + Intronic
1066572214 10:36785742-36785764 CAAGCGTGTGCCACACCAACCGG - Intergenic
1067051942 10:43026678-43026700 CCTGCGTCTGCCCCGGCAGCAGG - Intergenic
1072664975 10:97385990-97386012 CCTGTGTGTCCCCCTCCAGCTGG - Exonic
1074403077 10:113157817-113157839 GAAGCGTGTGTCCCTCCAGCTGG + Intronic
1074754667 10:116615550-116615572 CCTGAGTGAGCCCTGCCAGCTGG - Intergenic
1076060925 10:127413447-127413469 CCAGCCTCGGCCCCTCCAGCGGG + Intronic
1076356880 10:129859723-129859745 CCAGCGTGTGCCCCGCCAGCTGG - Intronic
1083282160 11:61633782-61633804 CCAGAGTGAGCCCAGGCAGCTGG - Intergenic
1083465029 11:62839607-62839629 GCAGCGTGTGCGTCACCAGCGGG + Exonic
1084421144 11:69061246-69061268 CCAGTGTCTGCCCAGCCGGCCGG - Intronic
1084650685 11:70487482-70487504 CCAAGGTGTCCCCCGCCACCAGG - Intronic
1085272933 11:75281040-75281062 CCAGGGTGTGGGCCGCCTGCTGG - Intronic
1089396229 11:118137776-118137798 CCAGGCTGTGCCACGCCAGGGGG + Intronic
1093525791 12:20102392-20102414 CAAGTGTGTGCACAGCCAGCAGG + Intergenic
1095099293 12:38163716-38163738 CCTGCGCGTGGCCCGGCAGCCGG - Intergenic
1095981724 12:47978099-47978121 CCAGGGTGAGCCCGGCAAGCAGG - Exonic
1096005645 12:48168867-48168889 GCACGGTCTGCCCCGCCAGCAGG + Intronic
1096243803 12:49973491-49973513 CCACCGTGGCCCCCACCAGCTGG - Exonic
1097000395 12:55871571-55871593 CAAGTGTGTGCCCCGACACCTGG + Intergenic
1097559789 12:61188943-61188965 CCATCTTGTTGCCCGCCAGCTGG - Intergenic
1098595774 12:72272338-72272360 GCAGCATGTGCCCCGCCGCCGGG + Intronic
1100631972 12:96399365-96399387 CCGGGGTGTGACCCGCCAGCAGG + Intronic
1102414405 12:112748065-112748087 CCAGCGTGTGCCCTGGAAGATGG + Intronic
1103702955 12:122857107-122857129 CCAGGCTCTGCGCCGCCAGCAGG - Exonic
1105281096 13:18963020-18963042 CCAGCCTGTGTCCAGCCACCCGG + Intergenic
1105625175 13:22105940-22105962 TCAGCATGTGCCCCGGCAGCAGG + Intergenic
1111991391 13:95120828-95120850 CCAGTCTGTGCCCCGCCATGTGG - Intronic
1114558609 14:23576382-23576404 CCAGAGTGTGCCCTACCATCAGG - Exonic
1114621748 14:24100184-24100206 CCAGGGTTTGCCCAGCCAGGAGG - Exonic
1118313119 14:64707171-64707193 CCAGCGGGGGCCCTGGCAGCTGG + Intronic
1121020314 14:90575953-90575975 CCATGGTGAGCCCCGCCTGCTGG - Intronic
1122206388 14:100149990-100150012 CCAGCTTGTTCCCACCCAGCAGG + Intronic
1122268534 14:100557934-100557956 CCAGCATCTGCCCCGACACCCGG + Intronic
1122269663 14:100562980-100563002 CCCGCGTGGGCCCCGTGAGCCGG - Intronic
1122357781 14:101134319-101134341 GCAGCGGGTGCCCAGACAGCTGG + Intergenic
1122605866 14:102947407-102947429 ACAGCGTGTGCACTGCCAGGCGG - Intronic
1122630933 14:103107516-103107538 CCAGCGTGTGGCCCGGCCGCGGG + Exonic
1122666749 14:103334928-103334950 CCAGCGCGTCCCCCGAGAGCCGG - Intronic
1122783034 14:104151679-104151701 CCTGCGTGTCCCCGGCCAGGCGG + Intronic
1125717180 15:41825992-41826014 CCAGGGTGTCCCCAGCCATCAGG + Exonic
1128468256 15:67930555-67930577 CCAGCTTGTTCCCCATCAGCAGG - Intergenic
1128833890 15:70793932-70793954 CCAGCCTGCGCACCACCAGCAGG + Intergenic
1129667644 15:77588408-77588430 CCCGCGCCTGCCCCTCCAGCTGG + Intergenic
1131248980 15:90818746-90818768 CCTGGGTGCGCCCCACCAGCTGG - Intergenic
1133212457 16:4271283-4271305 CCAGCCTGTGCCACACCGGCGGG + Intronic
1137685748 16:50385597-50385619 CCATCCTTTGCCCCTCCAGCTGG - Intergenic
1139949238 16:70661118-70661140 CCAGCCTGTCCCCCTGCAGCTGG + Intergenic
1142202576 16:88768171-88768193 CCAGCTCTTGCCCCACCAGCTGG - Intronic
1142887351 17:2921021-2921043 CCTGTGTGTGCCCCTCCCGCTGG + Intronic
1143920344 17:10326611-10326633 CCAGCGTGTGCCACCACACCTGG + Intronic
1144315179 17:14053363-14053385 ACAGCGTGTGCCCCTTCAGGTGG - Intergenic
1144572509 17:16408263-16408285 GCAGGCTGTGCCCAGCCAGCTGG + Intergenic
1144848829 17:18233892-18233914 CAAGCGTCTGCCCCTCGAGCAGG - Exonic
1145944002 17:28759490-28759512 CCAGGCTCTGGCCCGCCAGCAGG - Exonic
1147325028 17:39665980-39666002 CCAGTGTGTGGACCGCCAGGAGG + Exonic
1149777708 17:59371097-59371119 CCAGCCAGAGCCCAGCCAGCAGG - Intronic
1150136346 17:62697336-62697358 CCAGCGTGTCCACCTCCAGCAGG - Intergenic
1152332063 17:79679112-79679134 TCAGCGCGTGCCCCGGGAGCTGG + Intergenic
1152530292 17:80914631-80914653 CGAGCGTGTGCACAGCCGGCTGG - Intronic
1152592092 17:81218723-81218745 GCAGGGTGTGGCCCGCCAGACGG - Intronic
1152927346 17:83093344-83093366 ACAGCGTGTGCCCCTCCAGGAGG - Intronic
1160425098 18:78773862-78773884 TCAGGGTGTGCCAGGCCAGCAGG + Intergenic
1160586700 18:79917236-79917258 CCAGGGGCTGCCCCGTCAGCTGG - Intronic
1160691827 19:463861-463883 GCAGCCTGTGCCCCGCAGGCCGG + Exonic
1161220700 19:3116801-3116823 CCAGGGTGTCCCCACCCAGCTGG + Intronic
1161290799 19:3492463-3492485 CCAGCCTGCGCACGGCCAGCTGG + Exonic
1161300998 19:3543276-3543298 CCAGCGTGTGGCCTGCCTGATGG - Exonic
1161357096 19:3825276-3825298 CCAGCGTGTGTGCCTCGAGCAGG - Exonic
1162385337 19:10357618-10357640 CCAGCGAGTGGCCCACCTGCTGG + Intronic
1166677169 19:44747484-44747506 CCAGCGGCTGCCCCGCCCCCAGG + Intergenic
1168114025 19:54210901-54210923 CCAGCGTGAGCCCAGCCACTAGG + Intronic
1168276289 19:55280400-55280422 CTAACGTGTGCCCCGCCCCCAGG + Intergenic
1168332436 19:55578382-55578404 CCAGTGCGTGCGCTGCCAGCGGG - Exonic
925396962 2:3541050-3541072 ACAGTGTGAGCCCAGCCAGCTGG - Intronic
925719963 2:6817519-6817541 CCAGCTTGTGCCCTGCCTCCTGG - Intergenic
925779600 2:7370136-7370158 CCAGCGTCTGCACCTCTAGCAGG + Intergenic
926058263 2:9789408-9789430 CCAGTGTGTGTCCTTCCAGCTGG - Intergenic
928141793 2:28735784-28735806 CAAGCGTGTGCCACCACAGCTGG + Intergenic
934886940 2:98033110-98033132 CCACACTGTGCCCCGACAGCAGG - Intergenic
937132631 2:119524553-119524575 CCAGCTTGGGCCCAGCCTGCGGG - Intergenic
937370900 2:121296529-121296551 CAAGCATGTGCACAGCCAGCTGG + Intergenic
938886246 2:135651984-135652006 CCAGCCTGTGCTCCAGCAGCAGG + Exonic
942928143 2:181457530-181457552 GCAGCGTGTCCGGCGCCAGCGGG - Exonic
945322643 2:208443242-208443264 CCAGCCTGCTCCCCTCCAGCAGG - Intronic
945979710 2:216299251-216299273 CCAGGGGGTGCCTTGCCAGCTGG + Intronic
948396270 2:237647571-237647593 GCAGCGAGTGCCCGGCCACCAGG - Intronic
1169237608 20:3943930-3943952 CAAGCGTGAGCCACGGCAGCCGG - Intronic
1174244947 20:49171739-49171761 CTAGCGTCTGCCCTGCCTGCAGG - Intronic
1175138488 20:56842538-56842560 CAAGCGTGTGCCCACCCAGCTGG - Intergenic
1178841859 21:36144167-36144189 CCACCGTGTGCCCAGCCCGCTGG - Intronic
1179999823 21:44990439-44990461 CCGGCCTGCGCCCCGCAAGCAGG + Intergenic
1180178054 21:46099645-46099667 CCAGCCAGTGCCCCGCGGGCTGG - Intronic
1181046755 22:20218286-20218308 CCTGGGTGTGCCCAGACAGCAGG + Intergenic
1181521513 22:23451061-23451083 ACAGCGTGAGCCCAGCCAGCTGG - Intergenic
1183598837 22:38828407-38828429 CCAGCAGCTGCCCCTCCAGCTGG + Exonic
1184148253 22:42623976-42623998 CAAGCGTGTGGCCCGCAGGCGGG - Intronic
954297653 3:49683078-49683100 CCGGCGTGTGCCCTTCAAGCAGG + Exonic
955380476 3:58434037-58434059 CCAGCGTGCACCCCGCCTGTCGG - Intergenic
959716817 3:109442735-109442757 CCAGCGTGTGACTCACAAGCTGG - Intergenic
961442476 3:126961186-126961208 TCAGCCTGTACCACGCCAGCAGG + Intergenic
961574487 3:127823310-127823332 CCCACGTGTGCCCGGCCCGCGGG + Intergenic
966894029 3:184428777-184428799 CCAGCTTGTGCCTGGCCAGCTGG - Intronic
968188596 3:196650965-196650987 CCAGAGTGTGCCCAGCATGCAGG - Intronic
968884314 4:3319147-3319169 CAGGCGTGTGCCACGGCAGCCGG - Intronic
969411843 4:7033617-7033639 CTAGGTTCTGCCCCGCCAGCCGG - Intergenic
969452370 4:7281931-7281953 CTGGCGTGTGCCCAGGCAGCTGG - Intronic
969638542 4:8383208-8383230 CCTGCCTGTGCCCTGCCTGCGGG - Intronic
972532610 4:39975134-39975156 CCAGCGTGTGCCACCACACCCGG - Intronic
979657256 4:123209727-123209749 CCAGCATGTGCCCCTGCACCTGG + Intronic
982901101 4:161003616-161003638 CAAGCGTGTGCACACCCAGCTGG + Intergenic
985523166 5:388618-388640 CCAGGCTGTGCCCCTCCAGTCGG - Intronic
985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG + Intronic
991107685 5:62862328-62862350 CGAGCATGTGCCCACCCAGCTGG + Intergenic
992080365 5:73230648-73230670 CGGGCGTGAGCCCCTCCAGCTGG - Intergenic
997193208 5:131959419-131959441 TCATGGTGTGGCCCGCCAGCAGG - Intronic
998139458 5:139691632-139691654 CCAGCCTGTGGCCCTGCAGCTGG - Intergenic
1001933416 5:175688551-175688573 ACGGCGTGGCCCCCGCCAGCAGG + Intergenic
1002467408 5:179414466-179414488 CCTGCCTGTGGCCCGACAGCAGG - Intergenic
1004396863 6:15253205-15253227 CCAGCGTGTGCCACCACACCCGG + Intronic
1007826640 6:44605823-44605845 CCAGCTTGGGCCTCTCCAGCAGG + Intergenic
1008274446 6:49526728-49526750 CCAGCGTGAGGGCCACCAGCCGG - Exonic
1009398728 6:63230221-63230243 GCAGGGTGAGCCCGGCCAGCTGG + Intergenic
1013462512 6:110388665-110388687 CCAGCGTGTGCTTCTTCAGCAGG - Intergenic
1015301356 6:131656155-131656177 CCAAGGTGTCCCCCGCCAGTAGG - Intronic
1019520679 7:1459395-1459417 CCAGCGTCTGTCCCGCCGGCCGG - Exonic
1019589828 7:1825421-1825443 ACAGCGTGAGCCCAGCCAGCTGG + Intronic
1019666286 7:2253731-2253753 CCTGTGTGTGCCCCGCAGGCAGG - Exonic
1023638555 7:42237013-42237035 CCAGCCTGCGCCCCGTCCGCGGG - Exonic
1026588054 7:71673642-71673664 CCAGCCTGTGCCCCCCAGGCTGG + Intronic
1027845407 7:83367594-83367616 CCAGCGTGTGCCTGGGCAGGCGG + Exonic
1029211784 7:98915333-98915355 CCAGCGTGTGCCACCACAGCTGG + Intronic
1032967878 7:137122244-137122266 CCAGCTTTTTCCCCGCAAGCAGG - Intergenic
1033683714 7:143620682-143620704 CCAGCCTGTGCCCCGCCTCCGGG + Intergenic
1033700898 7:143836956-143836978 CCAGCCTGTGCCCCGCCTCCGGG - Intergenic
1038373111 8:27012256-27012278 GCAGGGTGAGCCCGGCCAGCTGG + Intergenic
1039311365 8:36321406-36321428 GCAGGGGGGGCCCCGCCAGCTGG + Intergenic
1039547313 8:38419565-38419587 CCAGCTTGTGCACAGCCATCTGG + Exonic
1041792602 8:61714195-61714217 GCAGCGTCCGCCGCGCCAGCCGG + Intronic
1042219547 8:66460161-66460183 CCATCGTGTGCCTCCCCAGGAGG - Intronic
1044409474 8:91867918-91867940 CAAGCATGTGCACCCCCAGCTGG - Intergenic
1045432045 8:102123799-102123821 CCAGCGGGTGCCCCGGCCCCCGG + Intronic
1048329792 8:133463798-133463820 CCAGCCAGTGCCCCAGCAGCTGG - Intronic
1049471716 8:142777655-142777677 CCAGCGCTTGCCCGGCGAGCCGG - Intronic
1050483921 9:6114397-6114419 CAAGCGTGTGCACACCCAGCTGG - Intergenic
1057210585 9:93199015-93199037 CCAGCCTGGCCCCCTCCAGCTGG + Intronic
1057213162 9:93212356-93212378 ACAGTGTGTGGCCCCCCAGCAGG + Intronic
1058439091 9:104991224-104991246 CCAGCGCCGGCCCCGCCCGCCGG + Intergenic
1059453772 9:114387187-114387209 CAAGTCTGTGCCCTGCCAGCAGG - Intronic
1062481940 9:136756626-136756648 CTAGCCTGTGTCCCGCCTGCTGG + Intronic
1186791844 X:13007356-13007378 CCAGTGGGTGCCTAGCCAGCTGG - Intergenic
1197147407 X:123185097-123185119 CCAGCCTGTCTCCCGACAGCCGG - Intronic