ID: 1076362396

View in Genome Browser
Species Human (GRCh38)
Location 10:129898474-129898496
Sequence CAGAACAAGGAGAGGAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 326}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076362396_1076362403 6 Left 1076362396 10:129898474-129898496 CCTGAATTCCTCTCCTTGTTCTG 0: 1
1: 0
2: 1
3: 33
4: 326
Right 1076362403 10:129898503-129898525 GCCCCCCACCCCAACCCAGAAGG No data
1076362396_1076362413 18 Left 1076362396 10:129898474-129898496 CCTGAATTCCTCTCCTTGTTCTG 0: 1
1: 0
2: 1
3: 33
4: 326
Right 1076362413 10:129898515-129898537 AACCCAGAAGGATGGCACCATGG No data
1076362396_1076362408 10 Left 1076362396 10:129898474-129898496 CCTGAATTCCTCTCCTTGTTCTG 0: 1
1: 0
2: 1
3: 33
4: 326
Right 1076362408 10:129898507-129898529 CCCACCCCAACCCAGAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076362396 Original CRISPR CAGAACAAGGAGAGGAATTC AGG (reversed) Intronic
900123379 1:1059026-1059048 CAGAACCAGGAGAGGCAGTTTGG + Intergenic
901832957 1:11905176-11905198 CATAAAAAGGAGAGAAATTCTGG - Intergenic
904029211 1:27523533-27523555 CAGAACCAGGACTGGAATCCAGG + Intergenic
905622033 1:39456727-39456749 CTGAAAAAGGAGGGGAACTCTGG - Intronic
905925574 1:41747089-41747111 CAGCAGCAGGATAGGAATTCAGG + Intronic
907816102 1:57919562-57919584 CAGAGCAAGGATAGGAACCCAGG - Intronic
909715326 1:78701172-78701194 AAGAACAAGCACAAGAATTCTGG - Intergenic
909722369 1:78790263-78790285 GAGAAAAAGCAGATGAATTCTGG - Intergenic
909762111 1:79302807-79302829 CAGAACAAGAAGCAGATTTCTGG + Intergenic
909770290 1:79413854-79413876 CAAAACAAGCAGAATAATTCTGG + Intergenic
911443467 1:97961010-97961032 GAGAACATGAAGAGTAATTCTGG + Intergenic
911700995 1:100951648-100951670 CACAACATGGAGAGGATTGCAGG - Intronic
911786982 1:101963271-101963293 CAGAACAAGGAGAGTGATCATGG - Intronic
912156620 1:106929013-106929035 CAGAAAGAGGAGATGGATTCAGG + Intergenic
913145946 1:115990094-115990116 AAGAAACAGGAGAGGACTTCTGG + Intronic
916185668 1:162130293-162130315 CAGAACTAGGATTTGAATTCAGG + Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916636429 1:166674246-166674268 AAGAACAAGAAGAGGAAGACAGG - Intergenic
916883673 1:169046824-169046846 CATAACAAGGAGTGGAACACAGG + Intergenic
918148934 1:181781591-181781613 CAGAACATGGGGAGGAAGCCAGG + Intronic
919246338 1:194990613-194990635 CAGAAAAAGGAAAGGAAATGAGG + Intergenic
920742846 1:208597896-208597918 CAGAAACAGGAGAGGTATACTGG - Intergenic
921900089 1:220440981-220441003 GAGAAAGAGGAGAGGAATTCAGG + Intergenic
922223780 1:223628038-223628060 CGGAACAAGGCAATGAATTCTGG - Exonic
922723489 1:227910773-227910795 CAAACCGAGGAGAGGAATTCTGG - Intergenic
923322806 1:232852661-232852683 AAGAAAAAGGAGAGGAATACAGG - Intergenic
923411008 1:233709051-233709073 CAGGAAAAGGAGAGGAATGGAGG - Intergenic
1063929202 10:11012400-11012422 CAGAAAAAGGACAGACATTCAGG + Intronic
1063931285 10:11030759-11030781 CAGAACAAGTAGAAGATTGCTGG - Intronic
1065435287 10:25699168-25699190 CAGAAGTAGGAGATGAAGTCAGG + Intergenic
1066038186 10:31516079-31516101 CAGAACAAGGATTGAAATACTGG + Intronic
1067016060 10:42756877-42756899 CAAAACTAGGAGCGGAACTCAGG - Intergenic
1067894640 10:50165773-50165795 CAGAACAAGGACAAGAATTCAGG + Intergenic
1067954204 10:50774488-50774510 CAGAACCAGGACAAGAATTCAGG - Intronic
1068194467 10:53698116-53698138 AAGAGCATGGAGAGGAATTGTGG - Intergenic
1070278202 10:75028605-75028627 CAAAACAAAGAGAGGAAGACCGG + Exonic
1070539967 10:77408931-77408953 CAGAAGGTGGGGAGGAATTCAGG + Intronic
1072806640 10:98427591-98427613 CAGAACAAGGAGGGGATTGGGGG - Intronic
1074653210 10:115548861-115548883 CAGAACTGGGAGAGGAGTGCAGG - Intronic
1076362396 10:129898474-129898496 CAGAACAAGGAGAGGAATTCAGG - Intronic
1077243038 11:1521284-1521306 CAGCACAAGCAGAGGAAAACTGG + Intergenic
1078289752 11:9996948-9996970 CAGAACACAGACTGGAATTCAGG + Intronic
1078341571 11:10501185-10501207 CAAGGCCAGGAGAGGAATTCAGG + Intronic
1078445141 11:11398529-11398551 CAGAACCAGGATATGAACTCAGG + Intronic
1078929034 11:15899281-15899303 CAGAACATGGAGAGGAGTTTGGG + Intergenic
1079165602 11:18039407-18039429 CAGAGCAAGGATATGAATCCAGG + Intronic
1080740481 11:35059379-35059401 CAGAAAAAGGATTAGAATTCAGG - Intergenic
1080878220 11:36295966-36295988 CAGAGCTGGGAGAGGAATTTTGG - Intergenic
1081423530 11:42900108-42900130 AAGAACATGGAGAGGATTCCTGG - Intergenic
1083379648 11:62254891-62254913 CAGAACCAGGATATGAAGTCAGG - Intergenic
1083842820 11:65314676-65314698 CAGAACCAGGACAGGACTCCAGG + Intergenic
1084583843 11:70042342-70042364 CAGCACAGGGAGAGGAACTCAGG + Intergenic
1084933381 11:72574299-72574321 CTGGGCGAGGAGAGGAATTCAGG - Intergenic
1085484379 11:76849464-76849486 CAGAGCAAGAAGAAGGATTCTGG + Intergenic
1085722232 11:78922776-78922798 AAATACAAGGAGAGGCATTCGGG + Intronic
1086240077 11:84679793-84679815 TAGAACCAGGATTGGAATTCAGG + Intronic
1086795877 11:91101527-91101549 CAGAGCAAGGGGATGATTTCAGG - Intergenic
1087363410 11:97189195-97189217 CTGAACAAGAAAAGGAATTCTGG - Intergenic
1087907213 11:103712423-103712445 CAGAAGAAGTATGGGAATTCAGG + Intergenic
1088567787 11:111191232-111191254 CAGACCAAGGGGCAGAATTCTGG + Intergenic
1088753892 11:112869094-112869116 CAGAGCCAGGAGTGGAATCCAGG - Intergenic
1088773716 11:113061540-113061562 CAGAAGAGGGAAAGGAATACTGG + Intronic
1091463952 12:667520-667542 CAGCACACAGAGAGGAATCCAGG - Intergenic
1091703449 12:2678847-2678869 CAGGACAAGGAAAAGAATACTGG + Intronic
1092143158 12:6198015-6198037 GAGGACAAGCAGAGGAATTTTGG - Intergenic
1092283854 12:7117324-7117346 CATCACAAGGACAGGAATACTGG + Intergenic
1093026548 12:14250752-14250774 CACAATAAAGACAGGAATTCGGG + Intergenic
1093102553 12:15045481-15045503 CAGAACATGGGGAGGAATAAAGG + Intergenic
1093352696 12:18123217-18123239 AAAAACAAGGACAGGAATTGAGG + Intronic
1093987570 12:25553680-25553702 CATAACTAGGAGAAGAATTTAGG - Intronic
1094365001 12:29670945-29670967 AAAAAAAAGGATAGGAATTCAGG + Intronic
1095864403 12:46955856-46955878 CTGGAAAAGGAGAGGATTTCGGG - Intergenic
1096378168 12:51131825-51131847 CAGAAAAAGGAGAGGAAAGAAGG - Intronic
1096912669 12:54999832-54999854 TAAAATAAGGATAGGAATTCTGG + Intergenic
1097935724 12:65248928-65248950 CAAAACAGGCAGAGGAACTCTGG + Intergenic
1098043515 12:66377234-66377256 CAGAACAAGAGGAGAACTTCTGG - Exonic
1101468469 12:104972336-104972358 CTGAACAAGAAGAGCAATGCAGG - Intergenic
1101630508 12:106488940-106488962 CAGCAAAAGAAGAGGAAATCTGG - Intronic
1103189050 12:118984863-118984885 TAGAACCAGGACAGGAATCCAGG - Intronic
1104337383 12:127912213-127912235 CACAACAAGGAGAGGTCTTCTGG - Intergenic
1109082354 13:57921060-57921082 GGGAAGAAGGAGAGGAAATCTGG - Intergenic
1109251581 13:60027267-60027289 CAGAGCAAGGCTGGGAATTCAGG + Intronic
1109441117 13:62376177-62376199 AAGAACAACGACAGGCATTCAGG + Intergenic
1110176995 13:72568826-72568848 CAGAACAAGGATTGGAATCCAGG + Intergenic
1110558894 13:76888734-76888756 CTGAACAAGGTGAGGAACACGGG - Intergenic
1111081249 13:83310511-83310533 CAATACAAAGTGAGGAATTCTGG - Intergenic
1114183502 14:20383645-20383667 CTGTACATGGAGAGGAAGTCAGG + Intronic
1114254763 14:20992094-20992116 GAGAACAAGGACTGGAAGTCAGG - Intronic
1114258166 14:21019751-21019773 GAGAACAAGGAGAAAAATTAGGG + Intronic
1114648394 14:24268329-24268351 CAAAACAAGGAGAGGGGCTCTGG - Intronic
1114853896 14:26414362-26414384 TAGAACTAAGAGAGGAACTCAGG - Intergenic
1115002182 14:28436222-28436244 TAGAATAAGGACAAGAATTCAGG + Intergenic
1115395842 14:32907375-32907397 CAGAACAAGGAGAAGAGTAGAGG - Intergenic
1115464169 14:33696303-33696325 CAGAACCAGGAGTAGAATACGGG - Intronic
1117850935 14:59968636-59968658 AAGAAGGAGGTGAGGAATTCAGG + Intronic
1118088446 14:62445502-62445524 AAGAAAAAGGAGGGGCATTCAGG - Intergenic
1120040276 14:79745106-79745128 CAGAACTAGGGGAGAAATTAAGG + Intronic
1120437526 14:84499392-84499414 CAGCACAAGGAAAGGAACTGAGG - Intergenic
1120465628 14:84853755-84853777 CATAACCAGGACAGGAATTCTGG + Intergenic
1120679336 14:87461354-87461376 GTAAACAAGGAGAGGAATTTAGG + Intergenic
1120894403 14:89516935-89516957 CAGGTCAAGGAGAGCAGTTCAGG - Intronic
1202894209 14_KI270722v1_random:188690-188712 AAGAAGAAGTAGAAGAATTCAGG - Intergenic
1124150454 15:27173014-27173036 CAGATGAATGAGTGGAATTCAGG - Intronic
1125189830 15:36977889-36977911 CAGTAAATGGAGTGGAATTCAGG - Intronic
1125242432 15:37591201-37591223 CAGAAAAAAGAGAGGAAGTAGGG - Intergenic
1125348261 15:38741422-38741444 CAGGACAAGGGATGGAATTCGGG + Intergenic
1126260879 15:46689597-46689619 TAGAACTAGGAGTGGAATGCTGG - Intergenic
1127820351 15:62649414-62649436 CAGAAGAAAGAGAGAAATTTTGG + Intronic
1127853040 15:62931787-62931809 CAAAACAAGAAGAGGAAATAAGG - Intergenic
1129108427 15:73323958-73323980 CAGAACAAGAACAGGCACTCAGG + Intronic
1129527936 15:76234213-76234235 CAGAACAAGTATAGGGATTTTGG + Intronic
1129851600 15:78796912-78796934 CAGAGCCAGGAGGCGAATTCAGG - Intronic
1129897861 15:79121998-79122020 GCCAACCAGGAGAGGAATTCTGG + Intergenic
1129947761 15:79556102-79556124 CAGAAAAAGGACATGAATCCAGG - Intergenic
1130215122 15:81960846-81960868 CAGAACTTGGTGAGGAATTAGGG - Intergenic
1130251392 15:82302186-82302208 CAGAGCCAGGAGGGGAATTCAGG + Intergenic
1130772123 15:86935138-86935160 CAGAAAATGGAGAGGAATCGGGG - Intronic
1131578319 15:93614457-93614479 CAAAACAAGGAAAGAGATTCTGG - Intergenic
1131999452 15:98164071-98164093 CAGAAAAAGGACACGAATTCAGG - Intergenic
1132984940 16:2760616-2760638 GAGAACTAGGAGAGAAATGCAGG - Intronic
1134032088 16:11000182-11000204 TAAAACATGGAGAGTAATTCTGG - Intronic
1134116659 16:11553752-11553774 CAGGACAAAGAGAGGAACGCAGG + Intronic
1137031173 16:35526167-35526189 GAGAACAAGGAGACGAACTGTGG + Intergenic
1137316013 16:47323878-47323900 GAGAACAGGGAGAGGAAGACGGG + Intronic
1137642293 16:50043161-50043183 AAGAACAAAGAAAGGAATTGTGG + Intergenic
1138496323 16:57411424-57411446 CAGAACAAACAGGGGAATTTGGG + Intronic
1138548526 16:57734665-57734687 CAGAACAAGGGTTCGAATTCTGG + Intergenic
1138744672 16:59349169-59349191 AAGAGCAAGGATAGCAATTCTGG + Intergenic
1139997989 16:70998560-70998582 GAGAACAAGAATAGGAATTTGGG - Intronic
1140963056 16:79935738-79935760 CAGAACAAAGATTGGAAATCTGG - Intergenic
1143075800 17:4342200-4342222 CAGGACAAGGAGAGATAATCAGG - Intronic
1144131157 17:12249059-12249081 CAGCACAGGGAAAGGAACTCGGG + Intergenic
1144667781 17:17113467-17113489 CATAAAAAGGAAAGAAATTCTGG - Intronic
1145045614 17:19612852-19612874 GAGGACAATGAGAGAAATTCTGG - Intergenic
1146464485 17:33075451-33075473 CAGAGCAGGGAGAGGAATCTGGG - Intronic
1147247509 17:39132039-39132061 CAGAGAAGAGAGAGGAATTCAGG + Intronic
1147762113 17:42805459-42805481 GAGAAGAGGGAGAGGAATTAGGG + Intronic
1149516161 17:57282594-57282616 CAGAACAGGGAGAGGAAGCAGGG - Intronic
1149977901 17:61285027-61285049 GAGACCAAGGACAGGAATTTAGG - Intronic
1151206497 17:72512052-72512074 CACAGCAAGGAGTGGCATTCTGG - Intergenic
1152495886 17:80671087-80671109 AAGAAAAAGAAGAGAAATTCAGG - Intronic
1153956301 18:10099204-10099226 CAGAGCACAGAGAGGCATTCAGG - Intergenic
1154114814 18:11604101-11604123 CAGAGCAAGGAAAGGTATCCGGG + Intergenic
1154261142 18:12833918-12833940 AAAAACATAGAGAGGAATTCAGG + Intronic
1157022027 18:43795043-43795065 AAGAACAGGGAGTGGAATTTGGG + Intergenic
1157976791 18:52337221-52337243 CAGAAACAGGAGAGAAATGCGGG - Intergenic
1158058155 18:53306412-53306434 GAGAACAAGGAAAGCAATCCAGG + Intronic
1160147959 18:76379499-76379521 AAGAATAAGGAGAGCCATTCCGG - Exonic
1162391262 19:10391445-10391467 CAGCGCAAGTAGAGGAAGTCAGG + Exonic
1164729877 19:30495489-30495511 CTGAACAAGCAGAGGCATGCTGG + Intronic
1165387504 19:35519467-35519489 AAGAACAGGGAGAGGAGTTTGGG - Intergenic
1165977931 19:39693658-39693680 CAGAATCAGGAGTGGAATCCAGG + Intergenic
1166004084 19:39895348-39895370 CAGGACATGGAGAGAAATACAGG - Intronic
1167045506 19:47046667-47046689 CGGAACCAGGAGAGGAAGGCTGG + Exonic
1168464355 19:56589784-56589806 CAGAACTCAGAGAGGACTTCAGG + Intergenic
925336752 2:3104386-3104408 CAGAGCAGGGAGAGGATTCCCGG + Intergenic
925743903 2:7029001-7029023 CCCCACAAGGAGAGGAAGTCCGG + Intronic
926195428 2:10761056-10761078 CAGCACAAGGAGTGGAGTTCAGG + Intronic
927029280 2:19103790-19103812 CTAAACAAGGACAGGAATCCAGG - Intergenic
927165789 2:20319914-20319936 AAGAACAAGGAGATGAATTTTGG + Intronic
927745120 2:25612000-25612022 CAGAAAAAGGAGAGAAATAAAGG + Intronic
927873654 2:26640211-26640233 GAGAACAAGGAAAGGACTTGGGG - Intronic
929153239 2:38767151-38767173 CAGAACTAGGATACAAATTCAGG - Intronic
932214831 2:69959889-69959911 CAAAATAATGAGAGCAATTCTGG + Intergenic
933829588 2:86195970-86195992 CACAACAAGGATAGGAACACGGG + Intergenic
934972210 2:98772929-98772951 TGGATCAAGGAGAGGAATTGAGG - Intergenic
935161646 2:100534586-100534608 CAGACCATGGAGAGGACTTGAGG + Intergenic
935566843 2:104618336-104618358 CAGAAACTGAAGAGGAATTCAGG + Intergenic
936635676 2:114254370-114254392 CAGAACTAGAAAGGGAATTCTGG - Intergenic
937821216 2:126313223-126313245 CAGAATAAGAACAGGAACTCTGG + Intergenic
938726131 2:134110067-134110089 CAGAAGAAGGAGATAAATTGAGG + Intergenic
938811398 2:134856273-134856295 CAGAACAAGAATTTGAATTCAGG + Intronic
939259626 2:139790397-139790419 AAGAACATAGAGGGGAATTCAGG - Intergenic
940323957 2:152405402-152405424 CAGAACAAGGACAGGATGTTGGG - Intronic
940745066 2:157558106-157558128 AAGGAGAAGGAGAGGAATCCAGG + Intronic
941308477 2:163899205-163899227 TAGATCAAGCAGAGGAATTCTGG + Intergenic
943126978 2:183805758-183805780 CTGAAGAAGGAGGGGATTTCAGG + Intergenic
943511742 2:188835453-188835475 CAGAACAAGGAGGGACTTTCTGG + Intergenic
943931826 2:193864524-193864546 CAGAACAAGTGGAGGAATGAGGG - Intergenic
944071166 2:195671056-195671078 CAGAATCATGAGAGGAATTCTGG - Intronic
946346261 2:219113232-219113254 CAGAACCAGGTCAGCAATTCAGG + Intronic
946361205 2:219220260-219220282 CAGCCCCAGGAGAGGAATTTGGG - Exonic
946971498 2:225097367-225097389 CCCAAAAAGGAAAGGAATTCTGG + Intergenic
947203602 2:227639646-227639668 CAGAACAAGGAACGTAAATCAGG - Intergenic
947386784 2:229598681-229598703 CAAAACAAAGACAGCAATTCTGG + Intronic
947674566 2:231966151-231966173 AAGAAGAAGAAGAAGAATTCTGG - Intronic
948233816 2:236371596-236371618 CAGGACAAGGTGAGGGCTTCAGG - Intronic
1168918130 20:1508333-1508355 AAGACAAAGGAGATGAATTCTGG + Intergenic
1168930041 20:1614425-1614447 GAGGACAAGAAGAGGAATTGTGG - Intronic
1168934444 20:1651303-1651325 GAGGACAAGAAGAGGAATTATGG - Intronic
1169284656 20:4297846-4297868 CTGAACAAGGAGAAAAAGTCAGG - Intergenic
1170505931 20:17025830-17025852 CATAAATAGGAAAGGAATTCAGG - Intergenic
1170788662 20:19490023-19490045 CAGAAACAGGTGAGCAATTCAGG - Intronic
1170916826 20:20634675-20634697 AAGAACAGGGATAGGAAGTCTGG - Intronic
1171463203 20:25310258-25310280 CAGAACAGGGAGGGCATTTCTGG + Intronic
1173624888 20:44465576-44465598 CAGAACAAGCAGAAGAATAATGG - Intergenic
1174488348 20:50875029-50875051 CAGAAGAAGGAGAGGGCTCCCGG - Intronic
1175296008 20:57909206-57909228 CAGAACAACGAGGGCGATTCAGG + Intergenic
1176642313 21:9317619-9317641 CAAACCAAGGAGATGAATTTTGG + Intergenic
1177739318 21:25135230-25135252 GAGAACATGGGGAGGAAATCTGG + Intergenic
1177781622 21:25628262-25628284 CAGAACAAGGACATGATTCCAGG - Intergenic
1177823172 21:26054331-26054353 CAGAACTAGGCCAGGAATTGTGG - Intronic
1178111958 21:29377603-29377625 CAGAACCAGGAAAGGCATTTTGG + Intronic
1179095478 21:38310846-38310868 CAAAACATGGAGAGGAAGCCAGG - Intergenic
1179138209 21:38699186-38699208 CAGAACAAAGAGAGGAGCACTGG + Intergenic
1180351324 22:11806974-11806996 CAAACCAAGGAGATGAATTTTGG + Intergenic
1180375608 22:12090395-12090417 CACACCAAGGAGATGAATTTTGG + Intergenic
1180386878 22:12185103-12185125 CAAACCAAGGAGATGAATTTTGG - Intergenic
1181319939 22:21996660-21996682 CAGAAAAAAAAGAGGAATTTGGG - Intergenic
1181362969 22:22352944-22352966 CAGGAGAAGGAGAGGAGTCCAGG - Intergenic
1181375183 22:22452414-22452436 GAGAACAAAGAAGGGAATTCAGG - Intergenic
1184450120 22:44577705-44577727 CAGAACAAGGAGAGCATCTCAGG - Intergenic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1185230068 22:49674922-49674944 CAGAAAGAGGAGAGGAAGCCAGG + Intergenic
949623912 3:5847203-5847225 CAGGACATGGAAAGAAATTCGGG + Intergenic
949778962 3:7664343-7664365 GAGGACAAGGAGTGGAATCCTGG - Intronic
950479997 3:13238208-13238230 CAGGACCAGGAGAGGAAAGCAGG - Intergenic
950609872 3:14119351-14119373 CAGAACAGGAACAGGAACTCTGG + Intronic
951578040 3:24133724-24133746 CAGAGAAAGGACAGGAATTTGGG + Intronic
951657623 3:25027322-25027344 TACAACCAGGATAGGAATTCAGG - Intergenic
953784067 3:45897250-45897272 CAGGACCACGAGAGGAATCCTGG - Intronic
954285266 3:49614772-49614794 CAGAGCAAGGATAGGAAATAAGG - Intronic
954428396 3:50455895-50455917 CAGAACGAGGAGAGGAATGGGGG - Intronic
954805996 3:53221027-53221049 CAGATCAAGGAGGGGGATTGGGG + Intergenic
955275190 3:57540495-57540517 AAGAACAAGGATAAGTATTCAGG + Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
956195229 3:66647730-66647752 CGGAGCAAGGATAGGAATCCAGG - Intergenic
956362043 3:68458987-68459009 CAGAAAAAGGAGCTGAATTGTGG + Intronic
956455920 3:69420498-69420520 CAGAACAAGGACTCAAATTCAGG + Intronic
957097803 3:75793026-75793048 CAAACCAAGGAGATGAATTTTGG - Intergenic
959191340 3:103115180-103115202 AAAAACAAGGAGAAGAATTCAGG + Intergenic
959206131 3:103309230-103309252 CCTAAAAAGGAGAGCAATTCAGG - Intergenic
959867239 3:111284831-111284853 GAGATCAAGGAGATGAATTTTGG - Intergenic
960532656 3:118782330-118782352 CATAAGAAAGAGAGCAATTCGGG + Intergenic
961746841 3:129069226-129069248 CAGAGCAAGGACACGAATTTGGG - Intergenic
961854434 3:129855512-129855534 CAGAAAAAGGAGAAGAAATGAGG + Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
962617734 3:137144340-137144362 AAGAACAAGGATAGCAATTCTGG - Intergenic
963014449 3:140808900-140808922 AGGAACAAGAAGAGAAATTCTGG - Intergenic
963325752 3:143861189-143861211 AAAAAAGAGGAGAGGAATTCTGG - Intergenic
964520435 3:157561149-157561171 AGGAACAAGGTGAGGAAATCTGG - Intronic
966358242 3:179104889-179104911 CAGATGAAGTACAGGAATTCAGG + Intergenic
966852552 3:184173197-184173219 AGTAACCAGGAGAGGAATTCAGG - Exonic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
1202744576 3_GL000221v1_random:87399-87421 CAAACCAAGGAGATGAATTTTGG - Intergenic
969126622 4:4953761-4953783 AAGAACAAGAAAAGGATTTCTGG - Intergenic
969856062 4:10000799-10000821 CAGATAAAGGAAAGGAATTCAGG - Intronic
970682941 4:18532461-18532483 CAGAACTAGGATGAGAATTCTGG + Intergenic
972848190 4:43015141-43015163 CAGGAGAAGGAGAGAAATTCAGG + Intronic
973025949 4:45271265-45271287 CTGAACAAGAAGAACAATTCTGG + Intergenic
973217354 4:47684489-47684511 CAGAACCAGGATAGGAGTTCTGG - Intronic
975673452 4:76804073-76804095 GAAAACAATGAGAGGAATTCAGG - Intergenic
977750413 4:100603195-100603217 CTGGAAAAGGAGAGGAAGTCAGG - Intronic
977989452 4:103423177-103423199 CATAACAAGGATATGGATTCTGG - Intergenic
978850666 4:113332107-113332129 CAGAAGAAGGAGAAGAATGGGGG - Intronic
978977881 4:114901393-114901415 CAGAACAAAGAAAGTTATTCAGG - Intronic
979303105 4:119110085-119110107 CACAGCAAGGAGAGGGAGTCTGG - Intergenic
981932420 4:150205352-150205374 GAGAATAAAAAGAGGAATTCTGG + Intronic
983040968 4:162925665-162925687 CATAAGAAAGAGAGGACTTCTGG - Intergenic
1202757208 4_GL000008v2_random:75837-75859 CACACCAAGGAGATGAATTTTGG + Intergenic
985768815 5:1796216-1796238 CAGAACCAGGCCAGGAATCCTGG - Intergenic
985813730 5:2111154-2111176 CAGCACAGGGGGAGGAACTCTGG - Intergenic
985893837 5:2737813-2737835 CAGAACACCGAGATGATTTCGGG + Intergenic
987026185 5:13929150-13929172 CTTAACAAGGAGGGGAATCCTGG + Intronic
987148186 5:15012895-15012917 CAGGAGTAAGAGAGGAATTCTGG + Intergenic
991902041 5:71470468-71470490 CAGAGCAAGGATAGAAATTAAGG + Exonic
995234825 5:109816178-109816200 CAGAACTGGGAGAGGATTTTAGG + Intronic
997870797 5:137503688-137503710 CAGAACCATGAGAAGAAATCTGG - Intronic
998805418 5:145913580-145913602 CAGAAAAAGGAGAAAATTTCCGG - Intergenic
999239550 5:150119635-150119657 CAGGACAAGGAGAGCCATGCTGG + Intronic
1000053640 5:157583744-157583766 CAGTAGAAGGAGGGTAATTCTGG - Intergenic
1000282869 5:159797316-159797338 CAGAATAAGGAGGAGAATCCTGG + Intergenic
1000354403 5:160379870-160379892 GAGAACATGGAGAGTAATTTGGG - Intergenic
1000538748 5:162512426-162512448 CAGAACAATTATAGAAATTCTGG + Intergenic
1000906892 5:166975171-166975193 CAGAACAGCGAGATGAATGCTGG + Intergenic
1001197845 5:169689685-169689707 CTGAACAAAGAAAGGAACTCAGG - Intronic
1002132291 5:177088997-177089019 CATAACAAGCAGAGGTATCCAGG + Intronic
1002537153 5:179882464-179882486 AAGAACATGCAGAGGAGTTCAGG - Intronic
1004136485 6:12972224-12972246 CAGAACCAGGATTGGAACTCAGG + Intronic
1004332674 6:14735974-14735996 CAGCACTGGGATAGGAATTCAGG - Intergenic
1005066337 6:21821449-21821471 CAGAACAAGGACACAAATACAGG - Intergenic
1006231096 6:32587471-32587493 TAGGACACAGAGAGGAATTCAGG - Intronic
1007004690 6:38349763-38349785 CAGGCCAAGGAGAAGACTTCAGG + Intronic
1007112225 6:39319503-39319525 TAGAACAATGGGAGGATTTCAGG + Intronic
1007643322 6:43361255-43361277 CAGAATAAGGAGAAGAAATTAGG + Intronic
1007765320 6:44156410-44156432 CAGAATAAGGACTGGAATGCAGG - Intergenic
1012626337 6:101407970-101407992 CAGCACAAGAAAAGGAATTTAGG + Intronic
1015102862 6:129501786-129501808 GAGAACAGGGAAAGGAATTGTGG + Intronic
1016278921 6:142389768-142389790 GAGGAAAAGGAGAGGAATTAGGG + Intronic
1016869606 6:148803759-148803781 CAGAACAAAGTGAGGAATGATGG - Intronic
1016890840 6:149005361-149005383 CAGAAGCTGGAGAAGAATTCGGG + Intronic
1017914432 6:158820123-158820145 TAAACCCAGGAGAGGAATTCAGG - Intergenic
1018271583 6:162084395-162084417 CAGAACAAGTTAAAGAATTCAGG + Intronic
1018300439 6:162396812-162396834 CCAAAAAAGGAGAAGAATTCTGG - Intronic
1018700022 6:166419062-166419084 CAGCAGAAGGAGAGTAAATCAGG - Intronic
1019106584 6:169672724-169672746 AAGAATAAGGAGAGGAATGAGGG + Intronic
1022017473 7:26363907-26363929 CAGAACCAGGACTGGAATTCCGG + Intronic
1022048878 7:26645699-26645721 CAGCACAAGGATGAGAATTCAGG - Intronic
1023037335 7:36143630-36143652 CAGAAGCAGGAGAGGAAGTGAGG - Intergenic
1024173743 7:46816516-46816538 GAGAACAAGCACAGGCATTCTGG - Intergenic
1026890721 7:73980342-73980364 CAGAACAGGGAGATGAAAGCTGG + Intergenic
1027985333 7:85280813-85280835 CAGAAAAAGGAAAGAAATTTTGG - Intergenic
1029629581 7:101742212-101742234 CATAACCTGGAGAGGAATTCTGG + Intergenic
1029999656 7:105045616-105045638 CATAAAAAGGAATGGAATTCTGG - Intronic
1030106331 7:105990448-105990470 GAAAACAAAGAGAGGAATTGAGG + Intronic
1030423742 7:109344702-109344724 CAGATCAAGGAGAGGACCTGAGG - Intergenic
1031064020 7:117084526-117084548 CAGACCCAGGATATGAATTCAGG - Intronic
1032404555 7:131646649-131646671 AAAAAAAAGGAAAGGAATTCTGG - Intergenic
1032612582 7:133431106-133431128 TAGAACAAGGACTAGAATTCTGG + Intronic
1033807398 7:144970263-144970285 GAGAACAGGGAGAGGACTTTGGG + Intergenic
1035529741 8:341747-341769 CAGACCAAGGAGAAGAATCCAGG + Intergenic
1036044016 8:5119813-5119835 CAGACCAAGGAGAGGTACCCAGG - Intergenic
1036064454 8:5363419-5363441 AAGAACAACAAGAGGAAGTCTGG - Intergenic
1036137535 8:6175612-6175634 CAGGAAAAGGAGAGGAACACGGG + Intergenic
1038762413 8:30396497-30396519 CAGAACGAGGAGAGGGATGTGGG + Intronic
1039182703 8:34884033-34884055 CAAAACAAGAAGAGAAATGCAGG + Intergenic
1041222195 8:55663165-55663187 CAGAACAAGCAGAGGCACTGTGG - Intergenic
1041282567 8:56226040-56226062 AAGAGAAAGGAGAGGACTTCTGG - Intergenic
1042460688 8:69062139-69062161 CAGAAAAATAAGAGGAATTTGGG + Intergenic
1042873679 8:73420603-73420625 CACAACAGGGAGTGGAATCCGGG + Exonic
1043812951 8:84765294-84765316 AAGAACAAGGAGAGGTAGTGGGG + Intronic
1044389998 8:91638850-91638872 TAGAACAAAGAAAGGAATTGAGG - Intergenic
1045486412 8:102634972-102634994 CAGCACAAGAAGAGGCACTCAGG + Intergenic
1046934755 8:119874946-119874968 CAAAACAAGCTGGGGAATTCAGG - Intronic
1047875365 8:129130827-129130849 AAAAACAAGGATAAGAATTCTGG + Intergenic
1048061520 8:130924138-130924160 CAGCACAAGGGGACCAATTCTGG - Intronic
1049141710 8:140961092-140961114 TAGAACTAGGACTGGAATTCAGG - Intronic
1050347162 9:4702219-4702241 CATTAAAAGGAGAGGAAATCTGG - Intronic
1052040723 9:23735875-23735897 CAGAGCAAGGAGAGGAAAACAGG + Intronic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1055162650 9:73149473-73149495 CAAAACAAGGAGAGGAAATATGG - Intergenic
1055317404 9:75047961-75047983 CAGAAGAGGAAGAGGAAGTCAGG - Intergenic
1056139114 9:83657353-83657375 CAGGAGAAGGAGTGGAAATCAGG - Intergenic
1056735353 9:89204986-89205008 CAACACAAGGAGAGGAAGTAGGG - Intergenic
1056779585 9:89539175-89539197 CAGAGCAAGGAGAGGCAGCCAGG - Intergenic
1057371360 9:94477350-94477372 ACCAACAAGAAGAGGAATTCTGG + Intergenic
1058535871 9:105959493-105959515 GAGGACAAGGAGAGCCATTCTGG - Intergenic
1059046816 9:110878088-110878110 AAGATAAAGGAGAGGAATCCAGG - Intronic
1060108322 9:120888756-120888778 CAGGACCAAGAGAGGAATTCTGG + Intronic
1061081212 9:128371465-128371487 CGGCAGAAGGAAAGGAATTCTGG - Intronic
1061664699 9:132153728-132153750 CAGAACCAAGAGAGGAAGTCGGG + Intergenic
1203688806 Un_GL000214v1:22904-22926 CAAACCAAGGAGATGAATTTTGG + Intergenic
1203713205 Un_KI270742v1:117348-117370 CAAACCAAGGAGATGAATTTTGG - Intergenic
1203537998 Un_KI270743v1:60697-60719 CACACCAAGGAGATGAATTTTGG + Intergenic
1203647469 Un_KI270751v1:81149-81171 CAAACCAAGGAGATGAATTTTGG - Intergenic
1185991862 X:4900516-4900538 CAGAAAAAAGAGAGAAATTTGGG - Intergenic
1188456267 X:30370003-30370025 CAGAACTGGGAGAGCATTTCAGG - Intergenic
1189014995 X:37087736-37087758 CAGAACGAGGAGAGGGATGTGGG + Intergenic
1189260534 X:39675489-39675511 AAGAAAAAGGAAAGGAATTCTGG + Intergenic
1189716698 X:43874438-43874460 CAAAACATGGATAGAAATTCAGG - Intronic
1189795220 X:44639487-44639509 CCAAACAAGGAAGGGAATTCTGG + Intergenic
1189860057 X:45262817-45262839 AAGACCATGGAGAGGTATTCTGG + Intergenic
1189897908 X:45674378-45674400 CAGAACATGGATAGGAATGAAGG + Intergenic
1192339997 X:70256522-70256544 CACAAGAAGGAGATGAATTTGGG + Intergenic
1192556418 X:72093459-72093481 CAGCACAAGGCCAGGTATTCAGG - Intergenic
1192622747 X:72695683-72695705 CAGTACAAGGAGAGAAGTGCTGG - Intronic
1196078070 X:111599559-111599581 CAGAACAAAAATAGGAATTTAGG + Intergenic
1196250933 X:113459446-113459468 CAGAACAAAGAAAGGGATACAGG + Intergenic
1198004281 X:132476172-132476194 CAGATCCAGGAGAGGAGCTCTGG - Intronic
1198091956 X:133340216-133340238 GAGAACAAGGGGGGGAACTCTGG - Intronic
1201147738 Y:11074138-11074160 CTGAACAGGGAGAGAAACTCAGG - Intergenic