ID: 1076364998

View in Genome Browser
Species Human (GRCh38)
Location 10:129916043-129916065
Sequence GGTCCCACAGGGGCTCCGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076364990_1076364998 -1 Left 1076364990 10:129916021-129916043 CCACACTCAGGAAATTCAATGGG No data
Right 1076364998 10:129916043-129916065 GGTCCCACAGGGGCTCCGAGGGG No data
1076364987_1076364998 20 Left 1076364987 10:129916000-129916022 CCATGATTCACGTGGAGCTGGCC No data
Right 1076364998 10:129916043-129916065 GGTCCCACAGGGGCTCCGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076364998 Original CRISPR GGTCCCACAGGGGCTCCGAG GGG Intronic