ID: 1076364998 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:129916043-129916065 |
Sequence | GGTCCCACAGGGGCTCCGAG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1076364990_1076364998 | -1 | Left | 1076364990 | 10:129916021-129916043 | CCACACTCAGGAAATTCAATGGG | No data | ||
Right | 1076364998 | 10:129916043-129916065 | GGTCCCACAGGGGCTCCGAGGGG | No data | ||||
1076364987_1076364998 | 20 | Left | 1076364987 | 10:129916000-129916022 | CCATGATTCACGTGGAGCTGGCC | No data | ||
Right | 1076364998 | 10:129916043-129916065 | GGTCCCACAGGGGCTCCGAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1076364998 | Original CRISPR | GGTCCCACAGGGGCTCCGAG GGG | Intronic | ||