ID: 1076367434

View in Genome Browser
Species Human (GRCh38)
Location 10:129931051-129931073
Sequence ATATAGATACAGATATATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1319
Summary {0: 1, 1: 2, 2: 10, 3: 164, 4: 1142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076367434 Original CRISPR ATATAGATACAGATATATGG GGG (reversed) Intronic
900827652 1:4939509-4939531 ATATTGATATTGATATTTGGAGG + Intergenic
901288236 1:8100207-8100229 ATATATATATATATATATGGAGG + Intergenic
901395379 1:8977237-8977259 TTATAGACACACATATCTGGTGG - Intergenic
901478794 1:9509672-9509694 AGATATATATATATATATGGGGG - Intergenic
902584676 1:17431364-17431386 ATATATATATATATATATGTGGG + Intronic
903488993 1:23713540-23713562 TTCTAGAGACAGTTATATGGAGG + Intergenic
903627032 1:24738259-24738281 ATATATATATATATTTATGGAGG - Intergenic
904016611 1:27426302-27426324 ATATAGGAACAGATTTAAGGGGG + Intronic
904426649 1:30428538-30428560 ATAAATATCCAGGTATATGGAGG + Intergenic
904815042 1:33189630-33189652 ATATATATATATATATATGCTGG - Intergenic
905101431 1:35526288-35526310 ATATATGTACATATATATGTGGG - Intronic
905130451 1:35752149-35752171 TTATAGTGCCAGATATATGGTGG - Intronic
905331294 1:37200891-37200913 ATATATATATATATATATGATGG + Intergenic
905342763 1:37290607-37290629 AGAGAGAGACAGAGATATGGAGG - Intergenic
905465590 1:38150860-38150882 ATATAGATATAGATATATAAAGG - Intergenic
906384391 1:45354832-45354854 ATATATATATATATATATGTTGG + Intronic
906563246 1:46776114-46776136 ATATATATATATATATATGATGG - Intronic
906876656 1:49546282-49546304 ATACATATACATATATATGATGG - Intronic
908130863 1:61074259-61074281 ATATATATATATATATATGTTGG + Intronic
908274653 1:62457779-62457801 ATACATATACATATATATGTGGG + Intronic
908947620 1:69518558-69518580 ATATACATACACATATATCAAGG - Intergenic
909036995 1:70604667-70604689 ACATATATACATATATATGATGG - Intergenic
909971724 1:81998780-81998802 ATATATATAGAGGTATATAGAGG - Intergenic
910048854 1:82953213-82953235 ATATATATATATATATATGATGG - Intergenic
910083259 1:83368500-83368522 ATATATATACATATATATGCAGG - Intergenic
910946627 1:92599521-92599543 ATATAAATATAGATATATAGAGG - Intronic
911081186 1:93933030-93933052 ATATATATATATATATATGATGG + Intergenic
911227902 1:95327212-95327234 ATATATATATATATATATGATGG - Intergenic
911300007 1:96160688-96160710 ATATATATACATATATATTAAGG + Intergenic
911335599 1:96576461-96576483 ATGTAGAAACAGGTATAGGGAGG + Intergenic
911622635 1:100083025-100083047 ATGTAGATAAATATATATAGTGG + Exonic
911639226 1:100269016-100269038 ATATAAATATATATATATGACGG - Intronic
911937551 1:103998085-103998107 ATATATTTACAGAAATTTGGAGG + Intergenic
911999167 1:104808762-104808784 AGATATATATAGATATATAGAGG + Intergenic
911999169 1:104808796-104808818 AGATATATATAGATATATAGAGG + Intergenic
912073927 1:105849064-105849086 ATATAAATACTTATATTTGGTGG + Intergenic
912187567 1:107297212-107297234 ATATATATATATATATATGATGG - Intronic
912301124 1:108518302-108518324 ATATAGAGAAAGAAATAAGGGGG - Intergenic
912926860 1:113920850-113920872 ATATAAATACACATATTTGTGGG + Intergenic
912944265 1:114071581-114071603 ATATACATATATATATATGTGGG + Intergenic
913181240 1:116324103-116324125 ATATATATATATATATATGATGG - Intergenic
913271438 1:117097566-117097588 CTATAGATACAGATCTAAGCAGG + Intronic
913424694 1:118714254-118714276 ATATATATGCATATATATGCAGG - Intergenic
913424695 1:118714278-118714300 ATATATATGCATATATATGCAGG - Intergenic
913479939 1:119278327-119278349 ATATAGAGACAGACAGATGATGG - Intergenic
914395126 1:147259102-147259124 ATACAGAAAAAGATATATGTGGG - Intronic
915057382 1:153146984-153147006 ATATAGATACATATCCATGTGGG - Intergenic
915772627 1:158444598-158444620 ATATATATACACACATATGTAGG + Intergenic
915800888 1:158792079-158792101 AGTTAGATACAGATATATTTAGG + Intergenic
916295333 1:163212909-163212931 ATAAAGACACAGATATAGGAGGG - Intronic
916430907 1:164727563-164727585 AGTTACATACAGACATATGGTGG + Intronic
916590693 1:166187199-166187221 ATATAGATAAATATAGATAGTGG - Intergenic
916617355 1:166456442-166456464 ATATACACACACATATATAGTGG + Intergenic
917162273 1:172071082-172071104 ATATATATATATATATATGCAGG - Intronic
917201206 1:172517430-172517452 ATATATATACACATATCAGGGGG - Intergenic
917231130 1:172839287-172839309 ATATATATATATATATATGGTGG + Intergenic
917624690 1:176833807-176833829 ATATATACACATATATATGTAGG - Intronic
917947180 1:179986534-179986556 ATATAGTTACAGACTTATAGGGG + Intronic
917960350 1:180138990-180139012 ATATATACACATATATATGTGGG + Intergenic
917961353 1:180147943-180147965 ACATATATACATATATATGCTGG - Intergenic
918202629 1:182281356-182281378 ATATATATATATATATATGATGG - Intergenic
918957860 1:191234522-191234544 ATATAGATATATATATATAAAGG - Intergenic
919153368 1:193728761-193728783 ATATATATACATATATATTTAGG + Intergenic
919177946 1:194043341-194043363 ATATATTTACACATATATGAAGG + Intergenic
919224956 1:194685644-194685666 AGAAAGATACAGATAAATAGTGG - Intergenic
919259174 1:195167662-195167684 ATATAGAGAAAAGTATATGGTGG + Intergenic
919531182 1:198723108-198723130 ATATATATATATATATATGAAGG - Intronic
920181762 1:204136411-204136433 ATATATATATATATATATGCCGG + Intronic
920983112 1:210856874-210856896 ATATATATATATATATATAGTGG - Intronic
921015396 1:211185673-211185695 ATATATATATATATATATAGTGG + Intergenic
921518644 1:216130517-216130539 ATATATATAAATATATATGATGG - Intronic
921521378 1:216158528-216158550 AAATAAATACATATATATGCAGG - Intronic
921538797 1:216386549-216386571 ATATATATATATATATATGCTGG + Intronic
921677848 1:217996479-217996501 ATATATATATATATATATGTAGG + Intergenic
921819783 1:219604224-219604246 CTATAGATATAGATATATCTGGG - Intergenic
921855334 1:219975800-219975822 AAATAGATATGGAAATATGGTGG + Intronic
921933998 1:220779160-220779182 ATACATATACATATATAAGGTGG - Intronic
922140618 1:222881877-222881899 ATATACATAAATATATATGAAGG - Intronic
922231170 1:223687983-223688005 ATAAAGATACAGATATAGAAAGG - Intergenic
922316267 1:224445181-224445203 ATATAGACATACATATATGTAGG - Intronic
922552509 1:226506472-226506494 ATATATATATATATATATGAAGG + Intergenic
922794178 1:228331403-228331425 ATATATATATATATATATGGTGG - Intronic
922870075 1:228895521-228895543 ATATATATATATATATATGAGGG + Intergenic
923464597 1:234236947-234236969 ATATATATATATATATATGGAGG + Intronic
923656925 1:235924914-235924936 ATATATATATATATATATGCAGG - Intergenic
923734305 1:236588720-236588742 ATATAGATAGGGATATATTCAGG - Intronic
923787426 1:237081506-237081528 ATATATATATATATATGTGGGGG - Intronic
923808283 1:237284661-237284683 ACATATATATATATATATGGTGG - Intronic
923972878 1:239225098-239225120 ATATATATACATATATATATAGG - Intergenic
924146618 1:241082795-241082817 ATATTGATACATATATAAAGTGG - Intronic
924402355 1:243699462-243699484 ATATATATATATATATATAGTGG - Intronic
924552071 1:245088375-245088397 ATGTAGATACACACATATAGTGG - Intronic
924644178 1:245861782-245861804 GTAAAGATACAGACTTATGGCGG - Intronic
1062949209 10:1484748-1484770 ATATAGGTACATATACAGGGAGG + Intronic
1063163716 10:3440800-3440822 ATATATATAAAAATATATAGTGG + Intergenic
1063178952 10:3578960-3578982 AGATAGATATAGATACATAGTGG + Intergenic
1063209407 10:3865059-3865081 ATATATACATATATATATGGTGG + Intergenic
1063307244 10:4915686-4915708 ATATATATATATATATATGTAGG - Intergenic
1063456682 10:6187998-6188020 ATATATATATATATATATGTAGG - Intronic
1063706205 10:8433354-8433376 TTATAGATATAGATATATAAAGG + Intergenic
1063756663 10:9018423-9018445 AACTAGATACATATATTTGGTGG - Intergenic
1063794819 10:9501877-9501899 ATATATATACACACATATGATGG - Intergenic
1063819222 10:9815411-9815433 ATGTACATACATATATATGCAGG - Intergenic
1064024991 10:11840974-11840996 ATATATATATATATATATGATGG + Intronic
1064961396 10:20968521-20968543 AAATACATACATAAATATGGAGG + Intronic
1065284861 10:24177254-24177276 ATATATATATATATATATGATGG - Intronic
1065401270 10:25304601-25304623 ATATAGAGAGAGATTTATGCTGG + Intronic
1065495624 10:26324801-26324823 ATATATATATATATATATGGTGG - Intergenic
1065575577 10:27114689-27114711 ATAAGGAAACAAATATATGGGGG + Intronic
1066597758 10:37070570-37070592 ATATATATACATATATATATAGG - Intergenic
1066658508 10:37717416-37717438 ATATATATATACATATATGATGG - Intergenic
1066958021 10:42191369-42191391 ATATACATATATATATATGAAGG - Intergenic
1067278270 10:44853033-44853055 ATATATATATATATATATGCTGG - Intergenic
1067470247 10:46531665-46531687 ATATATATATATATATATGATGG - Intergenic
1067654632 10:48181854-48181876 ATATATATATATATATATGAGGG - Intronic
1067910391 10:50340592-50340614 ATATACATACAGATATGCAGGGG + Intronic
1068073489 10:52224804-52224826 ATATATATATATATATATGATGG - Intronic
1068288125 10:54965621-54965643 ATATATATATATATATATGTTGG + Intronic
1068532614 10:58206976-58206998 ATATATATATATATACATGGTGG - Intronic
1068740913 10:60469415-60469437 ATATATATATATATATATGGTGG + Intronic
1068740915 10:60469441-60469463 ATATATATATATATATATGGTGG + Intronic
1068740917 10:60469463-60469485 GTATATATATATATATATGGTGG + Intronic
1068740919 10:60469485-60469507 GTATATATATATATATATGGTGG + Intronic
1068740925 10:60469553-60469575 ATATATATATATATATATGGTGG + Intronic
1068740927 10:60469579-60469601 ATATATATATATATATATGGTGG + Intronic
1068740929 10:60469603-60469625 ATATATATATATATATATGGTGG + Intronic
1068740931 10:60469637-60469659 ATATATATATATATATATGGTGG + Intronic
1068740933 10:60469663-60469685 ATATATATATATATATATGGTGG + Intronic
1068826817 10:61449679-61449701 AAATATATACATATATAAGGTGG - Intronic
1068957562 10:62832395-62832417 ATATATATGCATATATATGTAGG + Intronic
1069175468 10:65284152-65284174 ATATAGATACAAAGATGTGTTGG - Intergenic
1069280053 10:66644446-66644468 ATATATATATACATATTTGGGGG - Intronic
1069976599 10:72218202-72218224 ATATATATATATATATATGCCGG + Intronic
1070066219 10:73037522-73037544 ATATATATATATATATATAGTGG - Intronic
1070510282 10:77154640-77154662 ATAGAGATACAGATATATAGAGG + Intronic
1070896146 10:79984074-79984096 ATATACATATATATATATAGTGG - Intergenic
1070939332 10:80329536-80329558 ATATAGAGACAGACATTTTGAGG - Intergenic
1070985509 10:80686582-80686604 ATATAGGGACAGATAGAAGGAGG + Intergenic
1071036173 10:81248561-81248583 ATATAGATACAGATATATGCAGG - Intergenic
1071053916 10:81486815-81486837 ATACACATACATATATATGGGGG + Intergenic
1071218686 10:83437032-83437054 ATATACATACATATATATATAGG - Intergenic
1071267519 10:83977376-83977398 ATATAGATATAGATAGATAAAGG + Intergenic
1071414808 10:85431406-85431428 ATATATATACACATATATCATGG - Intergenic
1071759886 10:88590911-88590933 ATATATATTCATATATATGAAGG + Intronic
1072336170 10:94400673-94400695 CTATACATACAGATATAAGAGGG - Intergenic
1072392712 10:95004522-95004544 ATATATATATATATATATGATGG - Intergenic
1072785727 10:98279732-98279754 ATATATATATATATATATGATGG + Intergenic
1073238900 10:102041095-102041117 ATATATATATATATATATGTAGG + Intronic
1073835174 10:107433075-107433097 ATATAAATACAGAAAAATGAAGG - Intergenic
1073923760 10:108489329-108489351 ATATATATATATATATATAGTGG - Intergenic
1074361956 10:112830818-112830840 ATATATATATATATATATGAGGG - Intergenic
1074602258 10:114927014-114927036 ATATATATATATATATATGATGG + Intergenic
1074680358 10:115899650-115899672 AAATACATATAGCTATATGGAGG - Intronic
1075012209 10:118883511-118883533 ACAAAAATACAGATAGATGGAGG + Intergenic
1075982274 10:126750281-126750303 ATATATATATATATATATGATGG - Intergenic
1076308505 10:129483900-129483922 ATATAGATATAGATACCTTGGGG + Intronic
1076367434 10:129931051-129931073 ATATAGATACAGATATATGGGGG - Intronic
1077821537 11:5747503-5747525 ATATATATACACATACATTGTGG - Intronic
1077965466 11:7127821-7127843 ATATATATATATATAAATGGGGG - Intergenic
1078008519 11:7551022-7551044 CTATAGATATAGATATAAAGGGG - Intronic
1078078957 11:8189896-8189918 ATATATATGTATATATATGGAGG - Intergenic
1078092162 11:8270671-8270693 ATATAAATGCAGAGATAGGGCGG - Intergenic
1078422072 11:11220760-11220782 TAATACATACAGATACATGGGGG - Intergenic
1078811048 11:14763715-14763737 ATATGGATACAGATATTAGAAGG + Intronic
1078827199 11:14940538-14940560 ATATAGAAAGAGATTTATGAGGG + Intronic
1079173422 11:18117437-18117459 ATATATATACAGATATATAGTGG - Intronic
1079826282 11:25199670-25199692 ATATATATATATATATATGGTGG - Intergenic
1079850885 11:25532756-25532778 ATATAGATACAAATATAATTAGG - Intergenic
1079851796 11:25544245-25544267 ATATAAATAGAGATCTTTGGAGG - Intergenic
1079859751 11:25653721-25653743 ATATATATATATATATATGAAGG + Intergenic
1080001467 11:27355331-27355353 ATATATAGAGAGATATATGTAGG + Intronic
1080154197 11:29089024-29089046 ACATGTATACATATATATGGGGG - Intergenic
1080345976 11:31325701-31325723 ATATATATACATATATATGTAGG + Intronic
1082156326 11:48820898-48820920 ATATATATATATATATTTGGAGG - Intergenic
1082623268 11:55450910-55450932 ATATATATATATATATATGATGG - Intergenic
1082701287 11:56434603-56434625 ATACACATACACATATATGCGGG + Intergenic
1082773479 11:57227742-57227764 AAATAGATACACCAATATGGTGG - Intergenic
1082903059 11:58277240-58277262 ATATACACACATATATATAGTGG + Intergenic
1083035436 11:59632578-59632600 ATATATATAGATATATATGTAGG - Intergenic
1083452765 11:62757069-62757091 ATATATATATATATATATGCCGG - Intergenic
1085470596 11:76755060-76755082 ATATATATACACATATATCTGGG + Intergenic
1085659129 11:78346670-78346692 ATATATATATATATATATGGAGG - Intronic
1085818331 11:79765240-79765262 ATATATATATATATATATGCTGG - Intergenic
1085818332 11:79765287-79765309 ATATATATATATATATATGCTGG + Intergenic
1085965738 11:81522637-81522659 ATATACATACATATATACGTAGG - Intergenic
1085998162 11:81947532-81947554 ATATATATATATATATATGAAGG - Intergenic
1086285805 11:85249378-85249400 AAATACATACAGATATATATAGG - Intronic
1086720848 11:90119264-90119286 ATATATATATATATATAAGGTGG - Intergenic
1086965888 11:93027853-93027875 AGATAGATACAGAGATAAAGAGG - Intergenic
1087208704 11:95424018-95424040 GTATATATACACATATATGTGGG - Intergenic
1087221252 11:95548683-95548705 ATATAAATATAAATATATGCAGG + Intergenic
1087619631 11:100526957-100526979 ATATATATATATATATATGATGG + Intergenic
1087834049 11:102852437-102852459 ATATATATATATATATATGTTGG - Intergenic
1087942456 11:104115341-104115363 ATAAATATACACATATATGATGG + Intronic
1088032106 11:105263783-105263805 ATATATATATATATATATGTAGG - Intergenic
1088261287 11:107946366-107946388 ATATACACACATATATATGTGGG + Intronic
1088308240 11:108433279-108433301 ATATAGATATATATATATGCCGG + Intronic
1088826922 11:113503675-113503697 ATATATATATATATATATTGAGG - Intergenic
1089048741 11:115527397-115527419 ATATATATATATATATATGCAGG - Intergenic
1090133092 11:124166279-124166301 ATATATATATATATATATTGCGG + Intergenic
1090759552 11:129824348-129824370 AAACAGATACAGACATATTGTGG - Intronic
1091511892 12:1135491-1135513 AGGTAGACACAGATTTATGGAGG - Intronic
1091673776 12:2472553-2472575 ATATAGATACATATATTTAAAGG - Intronic
1091882006 12:3986878-3986900 ATATAGATAGATATAGATGTAGG + Intergenic
1092535571 12:9383393-9383415 ATATATATATATATATATGCCGG - Intergenic
1092640586 12:10504485-10504507 ATATATATATATATATATGTTGG + Intergenic
1092934117 12:13344117-13344139 ATATGTATACACATATATAGAGG + Intergenic
1092943441 12:13431577-13431599 ATATTTACACAGATATATGAAGG - Intergenic
1093218943 12:16395776-16395798 ATATATATATATATATATGATGG - Intronic
1093300989 12:17454588-17454610 ATATAGTTACAAATATAAAGTGG + Intergenic
1093323434 12:17742438-17742460 ATATATATATATATATATGGTGG - Intergenic
1093396399 12:18688554-18688576 ATATATATATATATATATGCTGG + Intronic
1093397139 12:18696319-18696341 ATATATATATATATATATAGTGG - Intronic
1093811735 12:23500229-23500251 ATATATATATATATATATAGTGG - Intergenic
1093981224 12:25477771-25477793 ATATATATACATATATATGCAGG + Intronic
1094035986 12:26072514-26072536 AAGTATATACATATATATGGGGG + Exonic
1094181924 12:27600884-27600906 ATTTGGATACATATATATTGTGG + Intronic
1094257263 12:28446520-28446542 ATATAAATACAGTTTTATGAAGG + Intronic
1094260827 12:28496944-28496966 ATATATATATATATATATGTAGG + Intronic
1094405544 12:30112325-30112347 ATATATATATATATATATGGGGG - Intergenic
1094784668 12:33833555-33833577 ATGAAGATACAAATATATGATGG - Intergenic
1094810312 12:34130555-34130577 ATATATATATATATATATGATGG + Intergenic
1095199836 12:39370795-39370817 ATATATATACATATATATTGTGG - Intronic
1095247598 12:39941116-39941138 ATATATATATATATATATGATGG - Intronic
1095541766 12:43317781-43317803 TTGTTGCTACAGATATATGGTGG + Intergenic
1095654046 12:44648706-44648728 ATATATATATATATATATGATGG - Intronic
1095665393 12:44791179-44791201 ATATATATATATATATATGATGG - Intronic
1095665394 12:44791210-44791232 ATATATATATATATATATGATGG + Intronic
1095687894 12:45056248-45056270 ATATATATATATATATATGTTGG - Intergenic
1096663686 12:53147082-53147104 ATATACATACACATATATATAGG + Intergenic
1096868593 12:54579333-54579355 ATATATATATATATATATGAGGG - Exonic
1096896685 12:54828140-54828162 TTATAGATATAGATATGTGAGGG + Intergenic
1097226741 12:57481223-57481245 AGAGAGAGACATATATATGGTGG - Intronic
1097334677 12:58369091-58369113 ATATATATATATATATATGTAGG + Intergenic
1097367199 12:58730087-58730109 ATATAGATACATTTATATATAGG - Intronic
1097547268 12:61019606-61019628 ATATATATATATATGTATGGTGG - Intergenic
1097659610 12:62414999-62415021 ATATATATATATATATATGAGGG + Intronic
1098287055 12:68917973-68917995 AGCAGGATACAGATATATGGTGG - Intronic
1098478224 12:70930414-70930436 ATATATATATATATATATGATGG - Intergenic
1098895734 12:76058190-76058212 ATATATATATATATATATGTAGG - Intronic
1099106398 12:78502050-78502072 ATATATACACACATATATGGAGG + Intergenic
1099234879 12:80071932-80071954 ATCTAAATACTAATATATGGAGG - Intergenic
1099248860 12:80227598-80227620 ATATAGATCCTAATATTTGGGGG - Intronic
1099266840 12:80457956-80457978 ATATAGATACATATTAATGGGGG - Intronic
1099374232 12:81877433-81877455 ATATACAGCCAGATATTTGGGGG - Intergenic
1099393214 12:82105287-82105309 ATATATATATATATATATGATGG - Intergenic
1099556616 12:84116187-84116209 ACATATATACATATATATAGTGG - Intergenic
1099720133 12:86350964-86350986 ATATATAGATATATATATGGTGG - Intronic
1099736172 12:86568541-86568563 ATATATATATATATATATGAAGG - Intronic
1100017324 12:90026477-90026499 ATATATATATATATATATGACGG - Intergenic
1100080892 12:90848693-90848715 ATATATATATATATATATGCTGG + Intergenic
1100093352 12:91000053-91000075 GTATAGATACAGATATAAATAGG - Intronic
1100512524 12:95290852-95290874 ATATATCTACATATATATTGTGG + Intronic
1100735213 12:97521425-97521447 ACATACATACATATATATGTTGG - Intergenic
1100822061 12:98440878-98440900 ATATATATATATATATATGATGG + Intergenic
1101357073 12:103990117-103990139 ATATATATATATATATATGTAGG + Intronic
1101626511 12:106448238-106448260 GAATATATACATATATATGGAGG + Intronic
1101672324 12:106887163-106887185 ATATACATACATATATATACAGG - Intronic
1102359828 12:112275615-112275637 ATATATATATATATATATGCTGG - Intronic
1102391117 12:112549441-112549463 ATATATATATATATATATGAGGG - Intergenic
1102429557 12:112871876-112871898 GTATATATACATATATATAGTGG + Intronic
1102540480 12:113615674-113615696 ATATATATATATGTATATGGTGG + Intergenic
1102857086 12:116303513-116303535 ATATAAATTAAGACATATGGAGG - Intergenic
1103174502 12:118850696-118850718 GTATAGATAAAGCTCTATGGAGG - Intergenic
1103189849 12:118992035-118992057 AAATAAATACACATATATTGGGG + Intronic
1103472528 12:121193257-121193279 AGAGAGATATATATATATGGGGG + Intergenic
1103831926 12:123787097-123787119 ATATAGATACAGATATAGACAGG - Intronic
1104210880 12:126687417-126687439 ACATATATACAGATATATGATGG + Intergenic
1104230830 12:126882487-126882509 ATATATATATATATATATGAAGG - Intergenic
1104356925 12:128095190-128095212 ATATAGATATATAGATATGGTGG + Intergenic
1105424234 13:20281026-20281048 ATATATATATATATATATGACGG - Intergenic
1105500745 13:20969738-20969760 ATATATATATATATATATGGCGG + Intergenic
1106046699 13:26148654-26148676 ATATATATATATATATATGAGGG + Intronic
1106146136 13:27051511-27051533 ATATATATCCATATATATGATGG - Intergenic
1106146167 13:27051817-27051839 ATATATATATATATATATGATGG + Intergenic
1107650351 13:42538665-42538687 ATATATATATATATATATGTAGG - Intergenic
1107860244 13:44653779-44653801 ATATATATATATATATATGGTGG - Intergenic
1107975734 13:45687126-45687148 ATATATATATATATATATGTAGG + Intergenic
1108246177 13:48516542-48516564 ATTTAGATGCAGAGATATGCAGG - Intronic
1108399783 13:50028352-50028374 AGATAAATACAGAAATATGCAGG - Intergenic
1108651227 13:52481839-52481861 ATATATATATATATATATGTGGG + Intergenic
1108826024 13:54413603-54413625 ATATATATATATATATATGAAGG + Intergenic
1108862327 13:54876928-54876950 ATATATATATATATATATGAAGG - Intergenic
1108994776 13:56714569-56714591 ATATAGATACTAATTTATTGTGG - Intergenic
1109008269 13:56906811-56906833 ATATATATATATATATATGTAGG + Intergenic
1109137446 13:58672308-58672330 CTATATATACATATTTATGGAGG + Intergenic
1109217942 13:59611388-59611410 ACATATGTACACATATATGGGGG + Intergenic
1109262067 13:60156914-60156936 ATATATATATATATATATGAAGG - Intronic
1109467455 13:62755635-62755657 ATATATATATATATATATGATGG + Intergenic
1109507137 13:63318060-63318082 ATAAAGATAGAAATATATGCTGG - Intergenic
1109602727 13:64654024-64654046 ATATATATGCATATACATGGAGG + Intergenic
1109659728 13:65441804-65441826 AAACAGATACAGGTACATGGAGG - Intergenic
1109660282 13:65449675-65449697 ATATATATATATATATATGGAGG + Intergenic
1109729957 13:66399853-66399875 ATATATAAACAGGTATTTGGTGG - Intronic
1109819031 13:67627375-67627397 AAATAGATACAGATCTGTGAGGG - Intergenic
1109911115 13:68911427-68911449 ATATATATATATATATATGATGG - Intergenic
1110064339 13:71084357-71084379 ATATACACACATATATATAGAGG + Intergenic
1110123035 13:71906785-71906807 ATAAAGATAAAGAGAAATGGAGG + Intergenic
1110446755 13:75592411-75592433 ATATATATATATATATATGAAGG - Intronic
1110446756 13:75592450-75592472 ATATATATATATATATATGAAGG + Intronic
1110505064 13:76276262-76276284 ATATATATATATATATATGATGG + Intergenic
1110881992 13:80583500-80583522 ATATATATATATATATATGATGG - Intergenic
1110881993 13:80583511-80583533 ATATATATATATATATATGATGG + Intergenic
1110975590 13:81830050-81830072 ATGTAGATATAGATATATGATGG + Intergenic
1111025400 13:82514503-82514525 ATATAGATAAATATATATTTTGG - Intergenic
1111064994 13:83078957-83078979 ATATACATATATATATATGTCGG - Intergenic
1111076691 13:83246105-83246127 ATATAGCTACAGACATATAACGG + Intergenic
1111087809 13:83399456-83399478 ATATATATATATATATATGAAGG - Intergenic
1111165296 13:84450135-84450157 ATATATATATATATATATGATGG - Intergenic
1111281108 13:86026500-86026522 ATATATATATATATATATGATGG - Intergenic
1111281109 13:86026517-86026539 ATATATATATATATATATGATGG + Intergenic
1111330087 13:86754563-86754585 ATATATATATATATATATAGCGG - Intergenic
1111330089 13:86754578-86754600 ATATATATATATATATATGGTGG + Intergenic
1111366623 13:87255138-87255160 ACATATATATATATATATGGAGG + Intergenic
1111378103 13:87407667-87407689 ATACAGATGCAGATATATTTAGG + Intergenic
1111399642 13:87717760-87717782 ATATATATATATATATATGGAGG + Intergenic
1111555675 13:89878331-89878353 ATATACACACACACATATGGTGG + Intergenic
1111560681 13:89941116-89941138 ATATATATATATATATTTGGTGG - Intergenic
1111617883 13:90684291-90684313 ATATATATTCATATATATGTAGG + Intergenic
1111695755 13:91621775-91621797 ATATATATATATATATATGAAGG + Intronic
1111750197 13:92319986-92320008 AAATAGAGAAAAATATATGGAGG - Intronic
1111883744 13:93992179-93992201 ATATATATATATATATATGTGGG + Intronic
1112124523 13:96449610-96449632 ATATGGAAATATATATATGGAGG - Intronic
1112208076 13:97345552-97345574 ATATAGAGAAAGAAAAATGGAGG - Intronic
1112227725 13:97556663-97556685 ATATAAATACAGACATTAGGAGG + Intergenic
1112228627 13:97565855-97565877 ATATAGTTAGAGATATGTGTGGG - Intergenic
1112347702 13:98604454-98604476 ATATATATATATATATATGAAGG - Intergenic
1113297223 13:108972380-108972402 ATATATATATATATATATAGTGG + Intronic
1113336591 13:109382862-109382884 ATATATATATATATATATGGTGG + Intergenic
1113679345 13:112232127-112232149 ATATATATACAGGTATATACAGG + Intergenic
1113705410 13:112428622-112428644 ATTTAGTTTCAGATATTTGGAGG + Intronic
1114720647 14:24877871-24877893 AAATAGATATAGATTTCTGGTGG - Intronic
1114852968 14:26402526-26402548 ATATATATATATATATATGTCGG - Intergenic
1114899202 14:27034921-27034943 ATATACATACTCATATATGTAGG - Intergenic
1115019654 14:28660812-28660834 ATATATTTACATATATATGGAGG - Intergenic
1115050734 14:29059431-29059453 GTATATATACATATATATGGTGG + Intergenic
1115111296 14:29826180-29826202 ATATATATACATATATATGATGG + Intronic
1115111297 14:29826206-29826228 ATATATATACATATATATGATGG + Intronic
1115111298 14:29826232-29826254 ATATATATACATATATATGATGG + Intronic
1115111299 14:29826258-29826280 ATATATATACATATATATGATGG + Intronic
1115111300 14:29826284-29826306 ATATATATACATATATATGATGG + Intronic
1115111301 14:29826310-29826332 ATATATATACATATATATGATGG + Intronic
1115111302 14:29826336-29826358 ATATATATACATATATATGATGG + Intronic
1115111303 14:29826362-29826384 ATATATATACATATATATGATGG + Intronic
1115111304 14:29826388-29826410 ATATATATACATATATATGATGG + Intronic
1115111305 14:29826412-29826434 ATATATATATACATATATGATGG + Intronic
1115111306 14:29826438-29826460 ATATATATACATATATATGATGG + Intronic
1115111307 14:29826462-29826484 ATATATATACATATATATGATGG + Intronic
1115111308 14:29826488-29826510 ATATGTATACATATATATGATGG + Intronic
1115111309 14:29826514-29826536 ATATGTATACATATATATGATGG + Intronic
1115111310 14:29826540-29826562 ATATGTATACATATATATGATGG + Intronic
1115111311 14:29826859-29826881 ATATATATATATATATATGATGG + Intronic
1115124772 14:29978538-29978560 ATATGGATAAAGATATATTAAGG + Intronic
1115197580 14:30818012-30818034 AAATAGACACAAATATATTGTGG + Intergenic
1115502509 14:34062054-34062076 ATATATATATATATATATGCTGG + Intronic
1115781081 14:36768954-36768976 ATATAGATATAGATAGATATAGG - Intronic
1115913392 14:38281805-38281827 ATATATATATATATATATGATGG + Intergenic
1115941415 14:38614623-38614645 ATATAGCTGTAAATATATGGAGG - Intergenic
1115952230 14:38734160-38734182 ATATACATATAGATATGGGGGGG + Intergenic
1116078253 14:40140974-40140996 ATATATATACACATATATACGGG - Intergenic
1116130049 14:40844375-40844397 ATATATATACACATATATGTGGG + Intergenic
1116652331 14:47609424-47609446 ATATATATATATATATATGATGG - Intronic
1116793985 14:49369929-49369951 ATATTCATATATATATATGGGGG - Intergenic
1116911091 14:50465272-50465294 ATATACATACAGAATTTTGGGGG + Intronic
1117091419 14:52254618-52254640 ATATAGAGACAGATGTTTTGAGG - Intergenic
1117587265 14:57222693-57222715 GTATATATATATATATATGGGGG - Intronic
1117613766 14:57511238-57511260 ATATATAAACACATATATGGGGG + Intergenic
1117705145 14:58458131-58458153 ATTTGGATATATATATATGGTGG + Intronic
1117772796 14:59151645-59151667 ATATAGAGACAGACACCTGGAGG - Intergenic
1118066522 14:62198172-62198194 ATATATAATCAGATATATTGTGG + Intergenic
1119138727 14:72245297-72245319 ATATACACACAGAAATATAGAGG + Intronic
1120238595 14:81923120-81923142 ATATATATATATATATATGAAGG + Intergenic
1120492856 14:85198660-85198682 ATATATATACACATATACAGAGG + Intergenic
1121169265 14:91839410-91839432 ATAGAGATACAGATGGATTGTGG - Intronic
1121670663 14:95708515-95708537 ATATATATATATATATATGGAGG + Intergenic
1121923420 14:97904753-97904775 ATATATATATATATATATGATGG - Intergenic
1122587661 14:102820569-102820591 ATATATATATATATATATGCTGG - Intronic
1122657213 14:103270118-103270140 AGCTAGAAACAGATATTTGGAGG - Intergenic
1123628271 15:22242681-22242703 TTTAAGATACACATATATGGTGG - Intergenic
1123673410 15:22683887-22683909 ACATAGACACAGAAATATAGAGG + Intergenic
1123786152 15:23675846-23675868 ATATATATACATATATATGAAGG - Intergenic
1123839653 15:24235358-24235380 ATATGTATATATATATATGGTGG + Intergenic
1123847335 15:24316033-24316055 ATACATATATAGATAGATGGGGG + Intergenic
1123852719 15:24377076-24377098 ATATATATATGTATATATGGTGG + Intergenic
1123866331 15:24523103-24523125 ATACATATATAGATAGATGGGGG + Intergenic
1123868574 15:24548487-24548509 AGATATATATATATATATGGTGG + Intergenic
1123927475 15:25131862-25131884 ATATATATATATATATATGAGGG + Intergenic
1124325414 15:28756872-28756894 ACATAGACACAGAAATATAGAGG + Intergenic
1124387182 15:29219647-29219669 ATATATATATATATATATGATGG + Intronic
1124444381 15:29716239-29716261 ATATAAATACAGATGTGAGGAGG - Intronic
1124922911 15:34043860-34043882 ATATAGGTACAGATACAAGTAGG - Intronic
1125069981 15:35543286-35543308 ATATATATATATATATATGATGG + Intronic
1125114332 15:36071641-36071663 ACATAGATATAGATATGTGTGGG + Intergenic
1125313336 15:38404073-38404095 ATATATATATATATATATGATGG - Intergenic
1125348196 15:38740834-38740856 TTTTAGTTACAGATATATGAGGG - Intergenic
1125412391 15:39418843-39418865 ATATATATATATATATATGATGG - Intergenic
1125478866 15:40066458-40066480 ATAAGGATACAAATATTTGGAGG + Intergenic
1126524261 15:49633032-49633054 ATATAGATATAGATATAAATAGG - Intronic
1126635207 15:50772832-50772854 ATATATATATATATATATGTTGG + Intergenic
1126759462 15:51956120-51956142 ATATAAATACACAAATATGCCGG + Intronic
1127252715 15:57257685-57257707 ATATATATATATATATATAGTGG + Intronic
1127365912 15:58290083-58290105 ATATAAATACGTATATAAGGTGG - Intronic
1127406171 15:58649062-58649084 ATATAATTACAGATATTTTGGGG + Intronic
1128607995 15:69051725-69051747 ATACAGATATATATTTATGGGGG + Intronic
1128726048 15:69989376-69989398 ATGCAGATATACATATATGGAGG + Intergenic
1128849728 15:70941682-70941704 TTATAGATGCTGATATAAGGAGG - Intronic
1128903052 15:71442686-71442708 ATATATATATATATATATGAAGG + Intronic
1128907539 15:71481344-71481366 ATATACATAAATATATATGAAGG - Intronic
1129511459 15:76126383-76126405 ATATATATATATATATATAGTGG + Intronic
1129538136 15:76330636-76330658 ATATATATATATATATATGAAGG - Intergenic
1129978256 15:79841923-79841945 ATATAAATAAACATATTTGGGGG + Intronic
1130229256 15:82084069-82084091 AGAGAGAAACAGAGATATGGGGG + Intergenic
1130272110 15:82457330-82457352 ATATAGATAGATATATAAAGGGG - Intergenic
1130365103 15:83229073-83229095 ATATATACACACATATATGATGG - Intergenic
1130464462 15:84184719-84184741 ATATAGATAGATATATAAAGGGG - Intergenic
1130488225 15:84410103-84410125 ATATAGATAGATATATAAAGGGG + Intergenic
1130499805 15:84488818-84488840 ATATAGATAGATATATAAAGGGG + Intergenic
1130586754 15:85189352-85189374 ATATAGATAGATATATAAAGGGG - Intergenic
1130607811 15:85333405-85333427 ATTTAGATCCAGATAGATGTGGG - Intergenic
1130821377 15:87499812-87499834 ATATATATATATATATATGCAGG + Intergenic
1131213908 15:90521152-90521174 CTAGAGATACCGATATTTGGGGG + Intergenic
1131480519 15:92776864-92776886 ATATATATATATATATATTGAGG + Intronic
1131610110 15:93951589-93951611 ATATGGATATAGATATACGTAGG - Intergenic
1131610124 15:93951746-93951768 ATATGGATATAGATATATGTAGG - Intergenic
1131610131 15:93951820-93951842 ATATGGATATAGATATATGTAGG - Intergenic
1131610135 15:93951883-93951905 ATATGGATATAGATATATATAGG - Intergenic
1131610142 15:93951977-93951999 ATATGGATATAGATATATGTAGG - Intergenic
1131610149 15:93952048-93952070 ATATGGATACAGATATATATAGG - Intergenic
1131610165 15:93952274-93952296 ATATGGATATAGATGTATGTAGG - Intergenic
1132100484 15:99019527-99019549 ATATATACACACATATATGAAGG + Intergenic
1132811947 16:1804243-1804265 ATATATATATATATATATAGAGG - Intronic
1132816502 16:1830871-1830893 GCATATATACACATATATGGCGG - Intronic
1133548313 16:6829310-6829332 ACATAAATACATATATAAGGAGG + Intronic
1133609987 16:7424258-7424280 ATATATATACATATATATGGGGG + Intronic
1133652442 16:7825405-7825427 ATATATTTATATATATATGGAGG - Intergenic
1134335140 16:13291995-13292017 ATATAGACTCAGATATAAGTAGG - Intergenic
1134358495 16:13507062-13507084 ATATATATATATATACATGGTGG - Intergenic
1134390192 16:13812838-13812860 ATATACATAGAGATATAGGTAGG - Intergenic
1135260952 16:20980356-20980378 ATATAAATATATATATATGTGGG + Intronic
1135610809 16:23865462-23865484 ATATATATATATATATATGCCGG - Intronic
1135664906 16:24327493-24327515 ATACATATATATATATATGGGGG + Intronic
1136073652 16:27804073-27804095 AGATAGATAAAGAAATAGGGAGG + Intronic
1136329790 16:29564997-29565019 ATATAGATATATATATAGAGGGG - Intergenic
1136444418 16:30304701-30304723 ATATAGATATATATATAGAGGGG - Intergenic
1136596893 16:31256981-31257003 ATATATATATATATATATGCAGG - Intergenic
1136666110 16:31814519-31814541 ATATATTTATATATATATGGTGG + Intergenic
1136866572 16:33762685-33762707 ATATAAATATATGTATATGGAGG + Intergenic
1137247309 16:46716356-46716378 ATATACATATATATATATGCGGG - Intronic
1137247311 16:46716393-46716415 ATACACATACATATATATGTGGG - Intronic
1137489251 16:48917341-48917363 ATATAGATATAGATATATGGGGG + Intergenic
1137813608 16:51376735-51376757 ATATAAATGAAGATATTTGGAGG + Intergenic
1138165448 16:54797240-54797262 ATATAGAAAGAGATTTATTGTGG + Intergenic
1138471356 16:57240370-57240392 ATATATATAAATATATATGTAGG + Intronic
1138627807 16:58266370-58266392 ATATATATATATATATATGCTGG - Intronic
1138718805 16:59054528-59054550 ATATATATATATATATATAGTGG + Intergenic
1138871305 16:60890451-60890473 ATATAGATAAATGTATCTGGAGG - Intergenic
1138960482 16:62023185-62023207 AGAAAGATACAAATATTTGGGGG - Intronic
1139149935 16:64370084-64370106 AGATAGAAATAGATATAAGGGGG - Intergenic
1139198994 16:64953243-64953265 ATATAGATATAGATATCTAACGG - Intronic
1139237340 16:65353774-65353796 ATATAGATACATGCATATGATGG + Intergenic
1139930309 16:70521008-70521030 CTATAGTCACAGATATTTGGGGG - Intronic
1140215514 16:73004290-73004312 ATACAGATAGAGAAAAATGGAGG - Intronic
1140312563 16:73863637-73863659 ATATAGAAACTGATCTATGTTGG - Intergenic
1140458970 16:75123483-75123505 ATATATATATATATATATGTAGG + Intergenic
1140862746 16:79033269-79033291 ATATATATATAAATATTTGGTGG - Intronic
1140966300 16:79969309-79969331 ATAGATAGACAGATAGATGGAGG - Intergenic
1141129122 16:81422981-81423003 ATATATATATATATATATGATGG + Intergenic
1141301239 16:82817505-82817527 ATATACATACAAATATAGAGTGG + Intronic
1141433524 16:83983974-83983996 AAATACATATATATATATGGTGG + Intronic
1203105587 16_KI270728v1_random:1353518-1353540 ATATAAATATATGTATATGGAGG - Intergenic
1203127927 16_KI270728v1_random:1608850-1608872 ATATAAATATATGTATATGGAGG + Intergenic
1142793665 17:2289565-2289587 ATATACACACATATATATGTGGG + Intronic
1143055815 17:4160989-4161011 AGAGACATACAGAAATATGGAGG - Intronic
1143330802 17:6133671-6133693 ATATAGATATAAAAATTTGGGGG + Intergenic
1143869389 17:9947269-9947291 ATACAGATACAGTTGCATGGGGG + Intronic
1144030517 17:11317885-11317907 AGACAAATACAAATATATGGGGG + Intronic
1144060386 17:11578849-11578871 ATATATATATATATATATAGAGG - Intergenic
1144105723 17:11983410-11983432 ATAGAGAGAAAGATGTATGGTGG + Intronic
1144497163 17:15755675-15755697 ATAAAGATATAGATAGATAGGGG + Intergenic
1144606728 17:16672935-16672957 ATAGAGATATAGATAGATAGGGG + Intergenic
1144904466 17:18629230-18629252 ATAAAGATATAGATAGATAGGGG - Intergenic
1145121475 17:20264219-20264241 ATAAAAATATATATATATGGAGG - Intronic
1146750865 17:35378481-35378503 ATATATATATATATATATGATGG + Intergenic
1146853063 17:36240011-36240033 TCATAGATACACATATATGTGGG + Intronic
1146868973 17:36363891-36363913 TCATAGATACACATATATGTGGG + Intronic
1147071848 17:37964526-37964548 TCATAGATACACATATATGTGGG + Intergenic
1147083375 17:38044052-38044074 TCATAGATACACATATATGTGGG + Intronic
1147099319 17:38168023-38168045 TCATAGATACACATATATGTGGG + Intergenic
1148939628 17:51197100-51197122 ATATATATATATATATATGGAGG + Intronic
1149128494 17:53265631-53265653 ATATACATATATATATATGCAGG + Intergenic
1149221843 17:54423989-54424011 ATATATATATATATATATGATGG + Intergenic
1149300011 17:55296444-55296466 ATTTATATACATATATATGGGGG + Intronic
1149340591 17:55682150-55682172 AGATAGATACAGATATAAATAGG - Intergenic
1149941454 17:60872351-60872373 ATATACATTCAGATATATATGGG - Intronic
1149941457 17:60872408-60872430 ATATACATACAGATATATATGGG - Intronic
1149941460 17:60872463-60872485 ATATACATACAGATATATATGGG - Intronic
1149941463 17:60872516-60872538 ATACACATACAGATATATATGGG - Intronic
1149941467 17:60872562-60872584 ATATACATACAGATATATATGGG - Intronic
1149941475 17:60872645-60872667 ATATACATACAGATAGATATCGG - Intronic
1149941479 17:60872776-60872798 ATACACATACAGATATATATGGG - Intronic
1150082333 17:62251320-62251342 TCATAGATACACATATATGTGGG + Intergenic
1150505341 17:65692998-65693020 AGATAGATATAGACATTTGGAGG - Intronic
1150529647 17:65963651-65963673 ATATAGATATAGATATAGATAGG + Intronic
1150869326 17:68887877-68887899 ATATATATATATATATATGGAGG - Intronic
1150887810 17:69108124-69108146 ATATAGGTAGAGATATACGTGGG - Intronic
1151047597 17:70939981-70940003 ATAGAGAAAAACATATATGGAGG + Intergenic
1151170724 17:72243624-72243646 AAACAGATACAGAAATATGATGG - Intergenic
1151288986 17:73134905-73134927 ACATACATACAGATATATTTAGG - Intergenic
1151321490 17:73355155-73355177 AAATATATATATATATATGGAGG - Intronic
1153067358 18:1061191-1061213 ATATAAATACATATATAAAGGGG - Intergenic
1153079449 18:1205101-1205123 ATATATATATATATATATGATGG - Intergenic
1153220721 18:2858518-2858540 ATATATATATATATATATGATGG - Intronic
1153378601 18:4410679-4410701 ATATATATATATATATTTGGGGG - Intronic
1153402956 18:4701355-4701377 ATATATATATATATATATGATGG + Intergenic
1153507205 18:5813440-5813462 ATACATATATGGATATATGGGGG + Intergenic
1154240221 18:12646603-12646625 ATATAAATAGAGATAATTGGAGG - Intronic
1154941464 18:21116697-21116719 ATATATAGAGAGATATATGTTGG + Intergenic
1155118624 18:22795852-22795874 ATATAAATATACATATATAGTGG + Intergenic
1155485211 18:26334002-26334024 ATATATATACATATATATGTGGG - Intronic
1155559212 18:27057668-27057690 ATATCGATACAGATAGATCTGGG + Intronic
1156582734 18:38395998-38396020 AAATAGACACATATATATAGAGG - Intergenic
1156787563 18:40933658-40933680 ATATATATATATATATATGGGGG + Intergenic
1156912416 18:42426316-42426338 AAACATATATAGATATATGGTGG - Intergenic
1156976818 18:43232247-43232269 ATATATATATATATATATGATGG + Intergenic
1157440508 18:47708030-47708052 ATATAGATACATATGTAGGGAGG - Intergenic
1158014933 18:52773483-52773505 ATATAGAGATATATATTTGGGGG - Intronic
1158046326 18:53159640-53159662 ATATAGATACAGATAGATTGGGG - Intronic
1158756982 18:60337171-60337193 ATATATATATATATATATGATGG + Intergenic
1158794919 18:60833582-60833604 AAATACATACAGATATATAGGGG - Intergenic
1158810194 18:61023312-61023334 ATATATATACATATATATGTTGG - Intergenic
1158881051 18:61779974-61779996 ATATATATATATATATATGTAGG - Intergenic
1158968836 18:62647299-62647321 ATAAATATACATATATATGTTGG - Intergenic
1159006444 18:63017048-63017070 ATACAAATACATATATATTGTGG + Intergenic
1159153165 18:64546557-64546579 ATATAGATAGATATATATATAGG - Intergenic
1159273883 18:66190621-66190643 ATATATATATATATATATGGAGG + Intergenic
1159303491 18:66609275-66609297 ATATATACACATATATATGTGGG - Intergenic
1159355416 18:67333505-67333527 ATAAACATACAGATATAGGCCGG + Intergenic
1159423393 18:68252081-68252103 ATATATATATATATATATGCAGG + Intergenic
1159766400 18:72495083-72495105 ATATATATAAAGTTATATGTTGG + Intergenic
1160333914 18:78019726-78019748 ATATATATACATATATATTATGG + Intergenic
1162271492 19:9619836-9619858 AGATAGATATAGATAGATAGAGG - Intronic
1162311096 19:9907705-9907727 ATAAAGAGACAGATATAGGCCGG + Intronic
1162560355 19:11414460-11414482 ATATATATATATATATATGAAGG - Intronic
1162560356 19:11414486-11414508 ATATATATATATATATATGAAGG - Intronic
1162847736 19:13406495-13406517 ATATATATATATATATATGAAGG + Intronic
1162881525 19:13663281-13663303 ACATAGATACAGAAATACTGTGG - Intergenic
1164280031 19:23761019-23761041 ATATATATACACATATATATAGG + Intergenic
1164524444 19:29003099-29003121 ATATATATATATATATATAGGGG + Intergenic
1164687761 19:30179673-30179695 ATATAGATATAGATATATGAGGG + Intergenic
1164889535 19:31811464-31811486 ATATATATATATATATATAGTGG - Intergenic
1164915487 19:32048452-32048474 ACATAGATATAGATATATTTAGG + Intergenic
1165019624 19:32913284-32913306 ATATATATATATATATATGGTGG - Intronic
1165151791 19:33765049-33765071 ATATATATATATATATATGATGG - Intronic
1165621714 19:37253576-37253598 ATATATATATATATATATGTTGG + Intergenic
1165633252 19:37319340-37319362 ATATATATATATATATATGCCGG - Intronic
1166233931 19:41442470-41442492 ATATATATACATATATATAATGG - Intergenic
1166404979 19:42513889-42513911 ATATATATATATATATATGGAGG - Intronic
1166649844 19:44564130-44564152 ATATATATATATATATATGATGG + Intergenic
1166962982 19:46510575-46510597 ATATATATATATATATATAGTGG + Intronic
1168058209 19:53875324-53875346 ATATATATATATATATTTGGAGG + Exonic
1168204395 19:54838755-54838777 GGATAGATACAGATAGATGATGG + Intronic
925343534 2:3153343-3153365 ATATATATATATATATATGATGG + Intergenic
925561973 2:5205896-5205918 ATATATATATATATATATGGGGG - Intergenic
925579917 2:5399989-5400011 ATATACATATATATATATAGTGG + Intergenic
925654846 2:6135546-6135568 ATATATATATATATATATGATGG + Intergenic
926283463 2:11468862-11468884 ATATATATATATATATATGAGGG + Intergenic
926364815 2:12123316-12123338 ATATATATATAGATATATATGGG - Intergenic
926364819 2:12123362-12123384 ATATATATATAGATATATATGGG - Intergenic
926364821 2:12123386-12123408 ATATATATATAGATATATATGGG - Intergenic
926468437 2:13221240-13221262 ATTTAGTTACAGATATTTGGAGG + Intergenic
926611173 2:14949675-14949697 ATATAGATATAGATATATAATGG + Intergenic
926617281 2:15009666-15009688 ATATATATACATATATATGTAGG + Intergenic
926794861 2:16610893-16610915 ATATATATATATATATATGTTGG - Intronic
927020056 2:19007249-19007271 AGATAGAAAAAGAGATATGGGGG + Intergenic
927303575 2:21543850-21543872 ATATAAATACAGATCTATTAAGG + Intergenic
927823522 2:26290413-26290435 GTTTAGATACATAAATATGGTGG + Exonic
928003545 2:27542612-27542634 ATATGGCTATAGTTATATGGGGG + Intronic
928415997 2:31092260-31092282 ATATATATATATATATATGAAGG - Intronic
928497986 2:31854323-31854345 ATAGAGATAAAGATAGATGATGG - Intergenic
928817292 2:35313892-35313914 ATAGAGATACAGATGTGTGGAGG + Intergenic
928889171 2:36182080-36182102 ATATAGATATATATATAGGTGGG + Intergenic
928889174 2:36182116-36182138 ATATAGATATATATATAGGTGGG + Intergenic
928889177 2:36182152-36182174 ATATAGATATATATATAGGTGGG + Intergenic
928889180 2:36182188-36182210 ATATAGATATATATATAGGTGGG + Intergenic
928889183 2:36182224-36182246 ATATAGATATATATATAGGTGGG + Intergenic
928889186 2:36182260-36182282 ATATAGATATATATATAGGTGGG + Intergenic
928892853 2:36225150-36225172 AGATAGATACAGATATGAGTAGG - Intergenic
929709037 2:44247720-44247742 ATATAAATAAATATATATGAAGG - Intergenic
929715544 2:44305789-44305811 GTAGAGATACAGAGAGATGGAGG - Intronic
930156981 2:48115687-48115709 ATATAGATATATATATAAAGGGG - Intergenic
930382013 2:50641996-50642018 ATATGCATATAGATATATGATGG + Intronic
930463662 2:51716485-51716507 ATATATATATATATATATAGTGG + Intergenic
930474662 2:51866169-51866191 ATATATATATATATATCTGGAGG - Intergenic
930749728 2:54922681-54922703 GTATATATACATATACATGGTGG + Intronic
930842724 2:55865193-55865215 ATATATATATATATATTTGGAGG + Intergenic
931388979 2:61823358-61823380 ATATATATATATATATATGATGG - Intergenic
931458445 2:62430714-62430736 ATATATATATATATATATCGAGG + Intergenic
932100088 2:68890638-68890660 ATATATATATATATATATGATGG - Intergenic
933134738 2:78719119-78719141 ATATAGATACATACATATATAGG + Intergenic
933246563 2:79982189-79982211 ATATATATATATATATATAGTGG - Intronic
933373766 2:81451710-81451732 GTTCAGAGACAGATATATGGGGG + Intergenic
933431492 2:82185864-82185886 ATATATATATAAATATATGAAGG + Intergenic
933446337 2:82384434-82384456 ATATATATACACATATGTGAGGG - Intergenic
934635262 2:95981269-95981291 ATATAAATATATGTATATGGAGG + Intronic
934798366 2:97123948-97123970 ATATATATATATAAATATGGAGG - Intronic
934835062 2:97579522-97579544 CTATATATATATATATATGGAGG + Intronic
935242490 2:101190702-101190724 ATATATATATATATATATGAGGG + Intronic
935282531 2:101531476-101531498 ATATAGACACACATATAATGTGG - Intergenic
935973231 2:108551595-108551617 ATATATATACATATATATATAGG - Intronic
935973234 2:108551965-108551987 ATATATATGTATATATATGGAGG + Intronic
936164910 2:110112896-110112918 AAATATATACATATATATGATGG + Intronic
936831221 2:116650120-116650142 ATATAGAAACAGAGACACGGAGG + Intergenic
936843679 2:116804032-116804054 ATATATACACATATATATGATGG - Intergenic
936931070 2:117789366-117789388 ATATAGATATAGGTATATATGGG + Intergenic
936985253 2:118305722-118305744 ACATACATATATATATATGGTGG + Intergenic
937000535 2:118462541-118462563 AAATAGACACAAATATATGTGGG + Intergenic
937525635 2:122765804-122765826 ATATATATATATATATATGTAGG - Intergenic
937764974 2:125650557-125650579 ATATACATACATATATATATAGG + Intergenic
937766538 2:125667440-125667462 ATATACATATACATATATGCTGG + Intergenic
937785744 2:125895398-125895420 ATATATATATATATATATAGGGG + Intergenic
937864360 2:126737666-126737688 ATATAGATACACATTTCTGTTGG - Intergenic
938162537 2:128998800-128998822 ATTTAGATCCAGATATATAGAGG - Intergenic
938231204 2:129660736-129660758 ATATATAAACAAATATAAGGAGG - Intergenic
939216019 2:139239232-139239254 ATATATATACATATATAAAGGGG - Intergenic
939220809 2:139299270-139299292 ATACAGATGTATATATATGGTGG + Intergenic
939298552 2:140303008-140303030 ATATATATATATATATATGAAGG - Intronic
939431527 2:142115852-142115874 ATACATATATATATATATGGGGG + Intronic
939839488 2:147169954-147169976 ATATATATATATATATATGGGGG - Intergenic
939993082 2:148894706-148894728 ATATATATATATATATAGGGTGG + Intronic
940010859 2:149053168-149053190 ACATACATACATACATATGGAGG + Intronic
940046133 2:149411859-149411881 ATACATATACATATATATGTGGG - Intronic
940157275 2:150671154-150671176 ATATATATATATATATATGATGG + Intergenic
940577677 2:155532339-155532361 ATATATATACATATATAAGCAGG + Intergenic
940735388 2:157445455-157445477 ATATGTATACAGGTATATGTGGG + Intronic
941172854 2:162161027-162161049 ATATATATATATATATATGTAGG + Intergenic
941229995 2:162899879-162899901 ATATACACACACATATATGATGG - Intergenic
941475521 2:165947165-165947187 ATATATATATATATATATGGGGG - Intronic
941487747 2:166103069-166103091 ATATATATATATATATATGACGG + Intronic
941605850 2:167595480-167595502 ATATACATACACACATGTGGAGG - Intergenic
941948792 2:171131056-171131078 ATATAGATACAAAGATATATAGG - Intronic
942039618 2:172045847-172045869 ATATATATATATATATATGACGG + Intronic
942550504 2:177111030-177111052 ATATATATACACATATATATGGG - Intergenic
942588859 2:177518684-177518706 ATATACAGACAGATAGATAGTGG - Intronic
942621945 2:177853631-177853653 ATATATATATATATATATGCAGG - Intronic
942757026 2:179353424-179353446 ATAAAGGTACAGATATCTGTAGG + Intergenic
942788767 2:179733949-179733971 ACATATATACATACATATGGGGG - Intronic
942960722 2:181827571-181827593 ATATAGATCCAGGTTTATGGCGG + Intergenic
943166012 2:184327530-184327552 ATATATATATATATATATAGTGG + Intergenic
943218218 2:185067108-185067130 ATACAAATACAGATATATACAGG - Intergenic
943245672 2:185447717-185447739 ATATATATATATATATATGCAGG + Intergenic
943245679 2:185447944-185447966 ATATATATATATATATATGCAGG - Intergenic
943282290 2:185951215-185951237 ATATGTATACATATATATGGTGG - Intergenic
943384802 2:187188395-187188417 ATATATATATATATATATAGGGG + Intergenic
943557232 2:189420548-189420570 ATAAATATACATATATTTGGGGG - Intergenic
943922591 2:193728673-193728695 ATATATGTACATATATATGCAGG - Intergenic
944017371 2:195058568-195058590 ATATATATATATATATATGAAGG + Intergenic
944974728 2:205035923-205035945 ATATATATATATATATATAGTGG - Intronic
945026828 2:205627575-205627597 ATATAGATTTAGATATAGAGAGG + Intergenic
945479100 2:210323666-210323688 ATATACATACACATTTGTGGGGG - Intergenic
945579942 2:211580899-211580921 ATATATATATATATATATGATGG + Intronic
945601067 2:211865181-211865203 TTATAGATATAGATATATATAGG - Intronic
945749059 2:213757486-213757508 AAATAGTTATAGAAATATGGTGG + Intronic
946430701 2:219625933-219625955 ATATGTATATATATATATGGGGG - Intergenic
946554669 2:220842291-220842313 ATATGTATACACATATATGTGGG + Intergenic
946698497 2:222385984-222386006 ATATATATATATATATATGAAGG - Intergenic
946743835 2:222826677-222826699 ATATATATATATATATATGTTGG - Intergenic
946753626 2:222919842-222919864 ATTTAGATGCAGATATATTGTGG + Intronic
946937237 2:224735028-224735050 ATATACATACAGATATTGGGAGG + Intergenic
946983672 2:225247779-225247801 ATATATATATATATATATGGTGG + Intergenic
947456577 2:230259767-230259789 ATATATATATATATATATGATGG - Intronic
947634644 2:231673762-231673784 ATATATATATATATATATGGAGG - Intergenic
948230749 2:236347510-236347532 ATATATATATATATATATGATGG + Intronic
948721068 2:239900311-239900333 ATATATATATATATATATGAAGG - Intronic
1169174039 20:3492908-3492930 ATATAAATACATATATATGTGGG + Intronic
1169774448 20:9237308-9237330 ATAAAGATTAGGATATATGGGGG - Intronic
1170107926 20:12772084-12772106 ATATATATATATATATATAGTGG - Intergenic
1170147129 20:13187937-13187959 ATATACATATATATATATGAGGG + Intergenic
1170336237 20:15273413-15273435 ATATATATATATATATATGGAGG - Intronic
1170336239 20:15273418-15273440 ATATATATATATATATATGAAGG + Intronic
1170444355 20:16409944-16409966 ATATATATATATATATATGTAGG - Intronic
1170444356 20:16409975-16409997 ATATATATATATATATATGTAGG + Intronic
1170653039 20:18260259-18260281 ATATGGATCCATATATATGGTGG + Intergenic
1170676485 20:18486222-18486244 ATATATATATATATATATGAAGG + Intergenic
1171130508 20:22648457-22648479 ATATATATATATATATATGATGG - Intergenic
1171143696 20:22764103-22764125 ATATATATATATATATATGATGG - Intergenic
1171157161 20:22886222-22886244 AAATAAACACAGATACATGGGGG - Intergenic
1172362556 20:34324165-34324187 ATAGATATACACAAATATGGTGG + Intergenic
1172968432 20:38855903-38855925 ATATATATATATATATATGTAGG - Intronic
1173255150 20:41389139-41389161 ATATAGGTATATATATATGTTGG - Intergenic
1173289994 20:41706433-41706455 ATATAGGCACAGAGATATGTTGG + Intergenic
1173324229 20:42018135-42018157 AGACAGATACAGAGACATGGTGG - Intergenic
1173422213 20:42911573-42911595 ATATATAAATAAATATATGGAGG - Intronic
1174136451 20:48383401-48383423 ATAAAGATACAAATGTCTGGAGG - Intergenic
1174241204 20:49136608-49136630 AAATACAGACAGATATATGTGGG + Intronic
1174394195 20:50236150-50236172 CTATAGTTACAGATATATGTGGG + Intergenic
1175344632 20:58263844-58263866 ATATACATACAAACATATAGAGG + Intergenic
1175526926 20:59640992-59641014 ATATAGATACATAGATATATGGG + Intronic
1175528594 20:59656394-59656416 ATATAGATATAGAGAGATGATGG - Intronic
1176384630 21:6132989-6133011 ATATATATATATATATATGATGG - Intergenic
1176709876 21:10141121-10141143 ATATATATACACATATATATTGG + Intergenic
1176713114 21:10324548-10324570 ATATATATATAAATATTTGGGGG - Intergenic
1177069410 21:16484652-16484674 ATATATATACACATATATATAGG + Intergenic
1177085045 21:16693291-16693313 ATATTGATACTGATATATATTGG - Intergenic
1177315912 21:19460874-19460896 ATATATATATATATATATGCAGG - Intergenic
1177354475 21:19989710-19989732 ATATACACATATATATATGGTGG + Intergenic
1177399724 21:20587269-20587291 ATATATATATATATATATGCGGG + Intergenic
1177409743 21:20714111-20714133 ATATATATATATATATATGAAGG - Intergenic
1177625726 21:23656895-23656917 ATTTAGATATAGATATACTGTGG - Intergenic
1177913519 21:27058953-27058975 ATATGTATACATATATATAGGGG - Intergenic
1177922512 21:27170030-27170052 ATATAAATATAGATGTATGTTGG - Intergenic
1178002064 21:28173033-28173055 ATATATATATATATATATAGTGG - Intergenic
1178013477 21:28314784-28314806 ATATATATATATATATATGCAGG - Intergenic
1178061163 21:28854522-28854544 ATAGAGATAGAGATATATAAAGG + Intergenic
1178136394 21:29632567-29632589 ATATATATACATATTTATGGAGG - Intronic
1178420780 21:32441696-32441718 AAATACATGCAAATATATGGGGG + Intronic
1179738842 21:43405263-43405285 ATATATATATATATATATGATGG + Intergenic
1179817781 21:43918503-43918525 ATTTAGAAACAGAAAAATGGGGG + Intronic
1180829494 22:18894679-18894701 ATATATATATATATATTTGGGGG - Intergenic
1181411512 22:22724751-22724773 ATATAGATATAGATAGATAGGGG + Intergenic
1181418451 22:22778425-22778447 ATATAGATATAGATAGATAGGGG + Intronic
1181824904 22:25507193-25507215 ATGTATATATACATATATGGAGG - Intergenic
1181930930 22:26401037-26401059 ATAAAGATATAGATATATCAAGG - Intergenic
1182046691 22:27279958-27279980 ATATATATATATATATATAGTGG + Intergenic
1182629752 22:31676096-31676118 ATATATATATATATATATGCCGG - Intergenic
1182855523 22:33514323-33514345 ATATATATACACACATATGCAGG - Intronic
1182882252 22:33743629-33743651 ATATAGAGAATGATCTATGGTGG - Intronic
1182941151 22:34278668-34278690 ATATACATACATATATATGTAGG + Intergenic
1184338405 22:43869781-43869803 ATATATATATATATATATGATGG + Intergenic
1184669332 22:46004547-46004569 AAATAGATCCAGATAGAGGGAGG - Intergenic
1184959136 22:47916277-47916299 ATATATATATATATATATGATGG + Intergenic
1184959138 22:47916303-47916325 ATATATATATATATATATGATGG + Intergenic
1184959142 22:47916349-47916371 ATATATATATATATATATGATGG + Intergenic
1184959156 22:47916551-47916573 ATATAGATAGATATATAAAGGGG + Intergenic
1203279584 22_KI270734v1_random:119984-120006 ATATATATATATATATTTGGGGG - Intergenic
949178613 3:1098800-1098822 ATATATATATATATATATAGTGG + Intronic
949321461 3:2815874-2815896 ATATATATATATATATATGATGG + Intronic
949340047 3:3019657-3019679 ATACACATATATATATATGGTGG - Intronic
949523713 3:4881902-4881924 AAATAGATCCAAATATATGTGGG + Intronic
949626553 3:5873866-5873888 ATATATATATATATATATGAAGG + Intergenic
949635335 3:5976137-5976159 ATATATATACATATATAAAGGGG + Intergenic
949736025 3:7172556-7172578 ATTTATATATAGATATATGTGGG - Intronic
949737053 3:7185484-7185506 ATATAGATAGAGCTACATAGTGG - Intronic
949752124 3:7365687-7365709 ATATATATACACATATATATGGG + Intronic
949784602 3:7726610-7726632 ATATATATATATATATATAGAGG - Intronic
950269194 3:11600031-11600053 ATATACATATGTATATATGGTGG - Intronic
951612508 3:24506640-24506662 ATATATATATATATAAATGGAGG + Intergenic
951900752 3:27655454-27655476 ATATAAGTTCAGATATAAGGTGG - Intergenic
952155733 3:30641690-30641712 ATATAGACACAGGCATATGGTGG - Intronic
952773805 3:37025581-37025603 ATATATATATATATATATAGTGG - Intronic
953004282 3:38963369-38963391 ATATATATATATATATATGATGG + Intergenic
953004283 3:38963400-38963422 ATATATATATATATATATGATGG + Intergenic
953004284 3:38963427-38963449 ATATATATATATATATATGATGG + Intergenic
953081867 3:39628513-39628535 ATATTTGTACAGATTTATGGGGG - Intergenic
953087845 3:39689682-39689704 ATAGAGATATAGACATATTGAGG - Intergenic
953224975 3:41010248-41010270 AGATAGATACACATATATATGGG + Intergenic
953573234 3:44089754-44089776 ATATAGATACAGCTATATGTAGG + Intergenic
955173485 3:56588085-56588107 ATATAGATATGGATATATGATGG + Intronic
955240341 3:57172300-57172322 ATATATATATATATATATGATGG - Intergenic
956679985 3:71769530-71769552 ATATATATATATATATATGGGGG + Intergenic
957056600 3:75447974-75447996 ATATATATATATATGTATGGTGG - Intergenic
957370224 3:79284096-79284118 ATATACATGCATATATATGATGG + Intronic
957460919 3:80519328-80519350 TACTAGATACAGTTATATGGAGG + Intergenic
957897714 3:86445360-86445382 ATATATATATATATATAAGGCGG - Intergenic
957932232 3:86895525-86895547 ATATATATACAAATGTTTGGGGG + Intergenic
957995749 3:87687882-87687904 ATATATATATATATATATGATGG + Intergenic
958044120 3:88262944-88262966 ATATAACTTCAGATATACGGTGG + Intergenic
958081986 3:88758240-88758262 GATTAGATACATATATATGGAGG + Intergenic
958184456 3:90102570-90102592 ATAGAGAGACAGGTATATGTAGG + Intergenic
958480327 3:94637857-94637879 ATATATATATATATATATGATGG - Intergenic
958537789 3:95426004-95426026 ATATATATATATATATATAGTGG + Intergenic
958555284 3:95666753-95666775 ACATACATACATACATATGGGGG + Intergenic
958794128 3:98688072-98688094 ATATACATACACATATATAGCGG - Intergenic
958880955 3:99669129-99669151 ATATATATATATATATATAGAGG + Intronic
958910592 3:99989661-99989683 ATATATATATATATATATAGAGG - Intronic
959195076 3:103169931-103169953 ATATATATATATATATATAGGGG + Intergenic
959233381 3:103688283-103688305 ATATAGAGATATAGATATGGAGG + Intergenic
959300579 3:104595335-104595357 ACACACATACATATATATGGAGG - Intergenic
959360654 3:105386653-105386675 ATATATATATATATTTATGGTGG - Intronic
960242417 3:115360755-115360777 ATATATATATATATATATAGTGG - Intergenic
960365697 3:116769549-116769571 ATATAGTTATACATATTTGGGGG + Intronic
960410636 3:117319385-117319407 ATATATATATATATATATGGAGG - Intergenic
960495146 3:118364166-118364188 ATATATATATATATATATGAAGG + Intergenic
960512348 3:118566046-118566068 ATATACATATATATATATGAAGG + Intergenic
962166744 3:133057469-133057491 ATATATATATATATATATGTGGG + Intronic
963071569 3:141309283-141309305 ATATATATATATATATATGGTGG - Intergenic
963274988 3:143320911-143320933 ATAGAGACACAGACACATGGAGG + Intronic
963357821 3:144232366-144232388 ATATATATATATATATATGAGGG - Intergenic
964536126 3:157724368-157724390 ATATATATATATATATATGATGG + Intergenic
964639216 3:158890723-158890745 CTATATATATATATATATGGTGG + Intergenic
964809468 3:160647799-160647821 ATATATATGCAAATATATAGAGG + Intergenic
964907380 3:161734201-161734223 ATATACATAAAGGTATATGAAGG + Intergenic
964908258 3:161745008-161745030 ATATATATATATATATATGCAGG + Intergenic
965045165 3:163568798-163568820 CTATAGATACTGATGTATCGAGG + Intergenic
965197516 3:165620923-165620945 ATATATATATATATATATTGGGG - Intergenic
965462682 3:168987363-168987385 AAATAGATTCAGATATATACAGG - Intergenic
965676815 3:171206215-171206237 GTATAGATACATATATATACTGG - Intronic
965893136 3:173539363-173539385 ATATATACACATATATATGATGG - Intronic
965934860 3:174095522-174095544 ATATATATATAGATATATAATGG - Intronic
965936569 3:174120949-174120971 CTGCAGATACAGATATATTGAGG - Intronic
966062309 3:175772954-175772976 AAATAGATACAGAGAAATCGAGG + Intronic
966344039 3:178958383-178958405 ATATATATATATATATATGATGG - Intergenic
966480512 3:180403274-180403296 ATGTAGATACAAACATATGTAGG - Intergenic
966774844 3:183534865-183534887 ATATACATACATATATATGATGG - Intronic
967002261 3:185347325-185347347 ATACAGATACAGATATATCAAGG + Intronic
967072979 3:185978032-185978054 ATATAGATACTTATATATACTGG - Intergenic
967132552 3:186485859-186485881 ATACATATATATATATATGGGGG - Intergenic
967374477 3:188785505-188785527 ATATATATATATATATATGATGG - Intronic
967488909 3:190066228-190066250 ATATACATACATATATATGATGG + Intronic
967488911 3:190066269-190066291 ATATACATACATATATATGATGG + Intronic
967657036 3:192063106-192063128 ATATATATATATATATATAGTGG + Intergenic
967722321 3:192828587-192828609 ATATATATATATATATATGGGGG - Intronic
968121890 3:196131660-196131682 AAATATATATACATATATGGGGG + Intergenic
968248040 3:197174716-197174738 ATTTATATACAGATAAATGAGGG + Intronic
969178029 4:5414674-5414696 ATGTATATCCATATATATGGGGG - Intronic
969201413 4:5609212-5609234 AGATAGATACATAGATAGGGAGG - Intronic
969287180 4:6210322-6210344 ATATACATACATACATATGGGGG + Intergenic
969823484 4:9738339-9738361 ATATATATATATATATGTGGTGG - Intergenic
970048230 4:11880748-11880770 ATATATCTACACATATATGCAGG - Intergenic
970196251 4:13553101-13553123 AGAGAGAAACAGATAGATGGGGG - Intergenic
971115234 4:23638496-23638518 ATATATATATATATATATGATGG - Intergenic
971190631 4:24425446-24425468 AAATAGACAAAGATATATGGTGG + Intergenic
971248615 4:24952647-24952669 ATATATATATATATATATAGTGG + Intronic
971383735 4:26124411-26124433 ATATATATATATATATATGATGG - Intergenic
971543465 4:27852876-27852898 ATATAGAAACAGTGATATGCTGG - Intergenic
971973981 4:33659681-33659703 ATATATATATATATATATGCAGG + Intergenic
972925999 4:44008392-44008414 TTAAAGATACAGATACAAGGAGG - Intergenic
973047629 4:45554162-45554184 ATATATATATATATATATGCAGG - Intergenic
973083841 4:46029685-46029707 ATATATATATATATATATGATGG + Intergenic
973161625 4:47024929-47024951 ATATATATATATATATATGATGG - Intronic
973179124 4:47246273-47246295 ATATATATATATATATATGATGG - Intronic
973615268 4:52671818-52671840 ATATATATATATATATATGCGGG + Intergenic
973905243 4:55522695-55522717 AAATACATACATATATATGGTGG - Intronic
974142638 4:57907507-57907529 ATATATATATATATATATGCAGG + Intergenic
974255802 4:59452797-59452819 ATATATATATATATATATGAAGG - Intergenic
974308662 4:60174949-60174971 ATATAAATATATATATATGGGGG - Intergenic
974425359 4:61736180-61736202 ATGTACATACATACATATGGAGG - Intronic
974593898 4:63992512-63992534 AAATAGAAACAGAAATATGAAGG - Intergenic
975010937 4:69350361-69350383 ATATAGATAGATATATATATAGG - Intronic
975687863 4:76935548-76935570 ATATATATACATATATATGTAGG - Intergenic
975704971 4:77102867-77102889 ATATATATATATATATATAGCGG - Intergenic
975925275 4:79443814-79443836 ATATATATATATATATATGAAGG + Intergenic
975967248 4:79988261-79988283 ATATATATATATATATATGTAGG + Intronic
976261767 4:83152233-83152255 AAATAGATAGACATATATAGAGG + Intergenic
976384011 4:84434339-84434361 ATATAGATATATATTCATGGTGG + Intergenic
976685864 4:87813975-87813997 ATATATATATATATATATGATGG - Intergenic
976773556 4:88681706-88681728 AAATAGATACACATATTTTGGGG + Intronic
976810634 4:89096767-89096789 ATATATATATATATATATGATGG + Intronic
976917266 4:90391422-90391444 CTATATATATAAATATATGGGGG + Intronic
977069671 4:92368884-92368906 ATGTAGCTACAGATTTATGCTGG + Intronic
977207991 4:94185304-94185326 ATATACATATACATATATAGTGG - Intergenic
977241633 4:94577467-94577489 ATATATATATATATATATTGAGG + Intronic
977336599 4:95707461-95707483 ATATAGAAAAAGTTATATTGGGG - Intergenic
977841378 4:101710333-101710355 ATATATATATATATATATGCAGG - Intronic
977868049 4:102053937-102053959 ACATATATACATATATATGAAGG - Intronic
978149706 4:105418597-105418619 ATATTGATATAGATACATTGTGG - Intronic
978272151 4:106903856-106903878 ATAAAGCTTCAGATATATTGAGG - Intergenic
978538033 4:109783817-109783839 ATATATATATATATATATGATGG + Intronic
978540107 4:109807430-109807452 ATATATATATATATATATGGAGG + Intergenic
978667682 4:111205479-111205501 ATAAATATACATATATATGTGGG - Intergenic
978867628 4:113533332-113533354 TCATAAATACAGACATATGGGGG + Intronic
979087489 4:116430935-116430957 ACATATATACATATATATGATGG - Intergenic
979119164 4:116872326-116872348 ATATACACACAGAGATATGAGGG + Intergenic
979124091 4:116945275-116945297 ATATAGTTACAGATATTTACTGG + Intergenic
979508536 4:121525806-121525828 AAATAGATACTGGTATATGTAGG - Intergenic
979529095 4:121749735-121749757 ATATATATAAATATATATGAAGG - Intergenic
979756911 4:124352044-124352066 GTATAGATACATGTGTATGGGGG + Intergenic
979782249 4:124667599-124667621 ATATAGATAAAGATATATAGAGG - Intronic
979977662 4:127217047-127217069 ACATAGATAGAGAAATATGTAGG + Intergenic
980040368 4:127932640-127932662 ATATATATATACATATATGTAGG + Intronic
980169841 4:129275766-129275788 ATATAGATAGAGATTTATCCTGG - Intergenic
980337250 4:131492317-131492339 ATATAGAAACAGTTATATATAGG - Intergenic
980644658 4:135627647-135627669 ATATATATATATATATATGATGG - Intergenic
980808557 4:137845212-137845234 ATATAGATATCTATATATTGAGG - Intergenic
980834159 4:138170202-138170224 ATATATATATATATATATAGTGG - Exonic
981559882 4:146035975-146035997 ATATATGTACATATATATGATGG + Intergenic
981590784 4:146358186-146358208 ATGTAGAATCAGATACATGGGGG - Intronic
981654491 4:147098064-147098086 ATATATATATATATATATGATGG + Intergenic
981965900 4:150602970-150602992 GGATAGATACAGATATATAAAGG - Intronic
981991147 4:150922400-150922422 ATATATATATATATATATGATGG + Intronic
982075764 4:151735740-151735762 ATATATATATATATATATGATGG + Intronic
982613253 4:157605250-157605272 ATATATATACATATATATAATGG + Intergenic
982679634 4:158413412-158413434 ATATATATATATATATATGATGG - Intronic
982704227 4:158689591-158689613 ATATATATATATATATATGAAGG - Intronic
982704228 4:158689620-158689642 ATATATATATATATATATTGTGG + Intronic
982904472 4:161050236-161050258 ATATATATATATATATATGAAGG + Intergenic
983243832 4:165264581-165264603 ATATATATATATATATATGATGG - Intronic
983484049 4:168312699-168312721 ATATAGATAGATATAGATGATGG + Intronic
983691738 4:170478618-170478640 ATATAGAGAGAGATATATATAGG + Intergenic
983691739 4:170478645-170478667 ATATAGAGAGAGATATATATAGG + Intergenic
983745748 4:171197620-171197642 ATATAGAAACATGTATATGTGGG - Intergenic
983746570 4:171207787-171207809 ATATATATATATATATATGCTGG - Intergenic
983890719 4:173026963-173026985 ATAGATATACAGATATATCAGGG - Intronic
984039695 4:174715869-174715891 ATATAGATATATAAATATGACGG - Intronic
984078961 4:175218778-175218800 AGATACATAGAGATATATGACGG - Intergenic
984103776 4:175518363-175518385 ATACACATACGTATATATGGAGG - Intergenic
984272347 4:177562526-177562548 ATATATATACACATATATGTAGG - Intergenic
984398979 4:179237598-179237620 ATATAGTAACAGATATATATGGG - Intergenic
984822149 4:183891390-183891412 ATATATATATATATATATGATGG + Intronic
985615584 5:918615-918637 AGATAGATACATATATAAAGGGG + Intronic
986024284 5:3835838-3835860 ATATATATATATATATATGAAGG + Intergenic
986145837 5:5076761-5076783 ATATATATATATATATATGATGG + Intergenic
986234981 5:5900841-5900863 ATATATAGAGAGAAATATGGTGG - Intergenic
986487698 5:8255963-8255985 ATATATATATAAATATATAGTGG - Intergenic
986810451 5:11352938-11352960 ATATAAATACATACATATGTAGG - Intronic
986842440 5:11713611-11713633 ATATATATACATATATATAAAGG + Intronic
987605453 5:20129254-20129276 ATAAAGATATAGATATATTTTGG - Intronic
987992728 5:25235807-25235829 ACATATATATATATATATGGAGG - Intergenic
987999742 5:25332180-25332202 ATATAGATATAGATAAATAGAGG - Intergenic
988071743 5:26298926-26298948 ATATATATACATATATATGATGG + Intergenic
988273534 5:29049778-29049800 ATATAGATATAGATATATGTGGG - Intergenic
988293361 5:29320042-29320064 ATATAGATACAGATATCTTTGGG + Intergenic
988474941 5:31576338-31576360 ATATATATATATATATATGATGG + Intergenic
988678474 5:33459158-33459180 ATATATATACCAGTATATGGAGG - Intronic
988902705 5:35751101-35751123 ATATATATATATATATATGATGG + Intronic
989018085 5:36964429-36964451 ATATAAATACAGATATTTACAGG + Intronic
990515676 5:56529103-56529125 ATATTCATATAGATATATGACGG + Intronic
990796404 5:59546525-59546547 AGATGTATACAGATATATGATGG + Intronic
990918738 5:60938791-60938813 ATAAAGCTACATATATATGGAGG - Intronic
991117600 5:62972038-62972060 ATATATATATATATATATGAAGG + Intergenic
991129609 5:63107024-63107046 TTATAAATACAGATACGTGGGGG + Intergenic
991266646 5:64727450-64727472 ATATATATATATATATATGGTGG - Intronic
991940381 5:71846093-71846115 ATATATATACGTATATATGATGG - Intergenic
992262547 5:74985841-74985863 ATATATATGCATATATACGGAGG - Intergenic
992535771 5:77701709-77701731 ATATATATATATATATATGATGG + Intronic
992679381 5:79138861-79138883 ATATATATATATATATATGTAGG + Intronic
992823680 5:80525878-80525900 ATATATATATATATATATGAAGG + Intronic
992855680 5:80859116-80859138 AAATATATATATATATATGGAGG - Intronic
993034653 5:82743870-82743892 ATATATATATACATATATAGTGG - Intergenic
993168882 5:84390139-84390161 ATATAAACACACATATATAGGGG - Intergenic
993607480 5:90010853-90010875 ATAGCAATACAGATAAATGGTGG + Intergenic
993737409 5:91494433-91494455 ATATATAAAAAGATATAGGGTGG - Intergenic
994335410 5:98559567-98559589 ATATATATATATATATATAGTGG + Intergenic
994365424 5:98911159-98911181 ATATATATATATATATATAGAGG + Intronic
994366136 5:98919583-98919605 ATATATAAGCAGATAAATGGTGG + Intronic
994466780 5:100144808-100144830 ATATATATACATATATATGTGGG - Intergenic
994471039 5:100207791-100207813 ATATATATGTACATATATGGAGG - Intergenic
994561048 5:101372868-101372890 ATATAGAGACACAAATATAGTGG + Intergenic
994928592 5:106151502-106151524 ATATATATACAGTTACATTGGGG - Intergenic
994992370 5:107013643-107013665 CTAGAGATACATATATATGCTGG + Intergenic
994994103 5:107037489-107037511 ATATTTATACATATGTATGGGGG - Intergenic
995431636 5:112085669-112085691 ATATATATACAGGTATGTGATGG - Intergenic
995559122 5:113362062-113362084 ATATAGACATAGATATATGAGGG - Intronic
995561802 5:113389845-113389867 ATACAAAGACAGGTATATGGTGG - Intronic
995694219 5:114861642-114861664 ATACAGATATATATATATGATGG - Intergenic
996073345 5:119160137-119160159 AGATATATATATATATATGGGGG + Intronic
996150935 5:120033983-120034005 ATATATATATATATATATGTAGG + Intergenic
996275209 5:121657755-121657777 ATATATATATATATATATAGTGG + Intergenic
996505622 5:124264919-124264941 ATATATATATATATATATGCAGG + Intergenic
996505624 5:124264986-124265008 ATATATATATATATATATGCAGG + Intergenic
996646895 5:125827679-125827701 ATATAGATACAGAGATAGGTAGG + Intergenic
996657792 5:125962196-125962218 ATATATAGACAGATAAATGTAGG + Intergenic
996866314 5:128126937-128126959 ATATATATATATATATATGTAGG - Intronic
997003595 5:129792138-129792160 ATATATATATATATATATAGTGG - Intergenic
997037298 5:130208028-130208050 ATATATATATAGATAGGTGGGGG + Intergenic
997871353 5:137507816-137507838 ATATATATATATATATATGATGG - Intronic
998361467 5:141591710-141591732 ATATATATATATATATATGAAGG + Intronic
998637897 5:143976864-143976886 ATATGGATATAGAGATATGGGGG - Intergenic
998667218 5:144311490-144311512 ATATAGATATAGATATCAAGAGG + Intronic
998749894 5:145308550-145308572 AGATAGATAGATCTATATGGTGG - Intergenic
998807122 5:145929194-145929216 ATATATATATATATATAGGGGGG - Intergenic
998807124 5:145929196-145929218 ATATATATATATATATATAGGGG - Intergenic
999078452 5:148819937-148819959 ATATATATATATATATATGATGG - Intergenic
999345273 5:150812902-150812924 ATATATATATATATATATGATGG + Intergenic
999675044 5:153991077-153991099 AAATAAATAAATATATATGGGGG + Exonic
999698989 5:154210942-154210964 TTGTAGATACAGGTAGATGGGGG + Intronic
999741218 5:154554409-154554431 ATATATATATATATATATGCTGG - Intergenic
999741222 5:154554622-154554644 ATATACATATATATATATGCTGG - Intergenic
1000130636 5:158294457-158294479 ATATAAATACATATAGATTGGGG - Intergenic
1000584879 5:163085250-163085272 ATATATATATATATATATGATGG + Intergenic
1000757358 5:165178021-165178043 ATATATATACATATATATGATGG - Intergenic
1000884796 5:166738777-166738799 ACATAGATACTGATAAATGTGGG + Intergenic
1000953730 5:167517385-167517407 AAATAGATACAATTATATTGAGG - Intronic
1001286766 5:170429376-170429398 ATATATATACATATATATGTAGG - Intronic
1001484216 5:172108313-172108335 ATATAGATTAAGAAAAATGGAGG + Intronic
1001609857 5:172991707-172991729 ATATAAATAAATATGTATGGGGG - Intronic
1001945771 5:175776415-175776437 ATATATATATATATATTTGGGGG - Intergenic
1001946561 5:175783637-175783659 ATATATATACATATATATATAGG + Intergenic
1002097867 5:176842493-176842515 ATATATATATATATATATGATGG + Intronic
1003281922 6:4700716-4700738 ATATATATATATATATTTGGAGG + Intergenic
1003306704 6:4935675-4935697 CTACAGATACAGAGATATTGTGG + Exonic
1003319026 6:5035791-5035813 ATATACATACATACATATGTGGG - Intergenic
1003473038 6:6454465-6454487 AGATAGATAAAGATATATGAGGG - Intergenic
1003518225 6:6835286-6835308 CTATAGATACAGATAGAGTGGGG - Intergenic
1003529449 6:6925646-6925668 AAATAGAGACAGATGCATGGAGG - Intergenic
1003754230 6:9098487-9098509 ATTTGGATACACATGTATGGTGG - Intergenic
1003761080 6:9179812-9179834 ATATATATATATATATATGAAGG + Intergenic
1004138942 6:12997404-12997426 ATATATAGATAAATATATGGGGG + Intronic
1005471884 6:26169288-26169310 ATATACACAGAGAGATATGGTGG + Intronic
1006182074 6:32160018-32160040 ATATAGAGAGAGATATATATTGG - Intronic
1006279809 6:33041936-33041958 ATATATATATATATATATGATGG - Intergenic
1006279810 6:33041962-33041984 ATATATATATATATATATGATGG - Intergenic
1006279811 6:33041986-33042008 ATATATATATATATATATGATGG - Intergenic
1006733709 6:36256434-36256456 AAATAAATATATATATATGGGGG - Intronic
1007355788 6:41315455-41315477 ATATAGATATAGATATATATAGG + Intergenic
1007634672 6:43291678-43291700 ATATATACACATATATATGATGG - Intergenic
1007889717 6:45276488-45276510 AAAAAGATACAGATATGGGGAGG - Intronic
1008181876 6:48341233-48341255 ATAAACATACATATATATGAAGG + Intergenic
1008443309 6:51557865-51557887 ATATATATATATATATATGAAGG + Intergenic
1008451605 6:51657701-51657723 ATATATACACACATATATGTGGG - Intronic
1008935491 6:56987535-56987557 AGAGACATACAGATAAATGGGGG - Intronic
1008996581 6:57666888-57666910 ATATATATATAAATATATGTAGG + Intergenic
1009185098 6:60566272-60566294 ATATATATAAAAATATATGTAGG + Intergenic
1009489299 6:64268040-64268062 ATATATATTCAAATATATAGTGG + Intronic
1009565855 6:65310367-65310389 CTATAGATATAGATATATCTGGG + Intronic
1009586473 6:65612193-65612215 ATATATATACATATATATACAGG - Intronic
1010036342 6:71329747-71329769 AAATAGATACAGGAATAGGGTGG - Intergenic
1010344474 6:74795607-74795629 ATATATATATATATATATGATGG + Intergenic
1010344628 6:74797472-74797494 ATATATATATATATATATGTTGG - Intergenic
1010465009 6:76157490-76157512 ATATAGATATAGATATATGATGG - Intergenic
1010512693 6:76740006-76740028 ATATATATATATATATATGATGG - Intergenic
1010512694 6:76740015-76740037 ATATATATATATATATATGATGG + Intergenic
1010623359 6:78104521-78104543 ATATAGATATGGAGATATGGGGG + Intergenic
1010725704 6:79329979-79330001 ATATAGATATAGATATATTGGGG + Intergenic
1010830728 6:80525320-80525342 ATATAGATAGATATATATATGGG + Intergenic
1010864554 6:80958921-80958943 ATATATATATATATATATGTAGG + Intergenic
1010928670 6:81774174-81774196 ATATAGAGCCAGTTATATGTTGG - Intergenic
1010979993 6:82361425-82361447 ACATAGTTACAGAGATATAGTGG + Intergenic
1011100636 6:83717001-83717023 AGATATATATAGATATATAGTGG + Intergenic
1011320129 6:86081602-86081624 ATATATATACATATATATATAGG + Intergenic
1011435490 6:87332314-87332336 ATATATATACATATATGGGGGGG - Intronic
1011435492 6:87332316-87332338 ATATATATATACATATATGGGGG - Intronic
1011585513 6:88920527-88920549 ACATACATACACATATATTGAGG + Intronic
1011769692 6:90661687-90661709 ATATATATATATATATATGGTGG - Intergenic
1011805568 6:91069171-91069193 AAATAGATACAGATATTTTAGGG + Intergenic
1011813256 6:91157585-91157607 ATATATATATATATATATGATGG - Intergenic
1011817171 6:91205951-91205973 ATATCCATACAGATATATGATGG - Intergenic
1011896922 6:92239278-92239300 ATATATATATATATATATGATGG - Intergenic
1012015639 6:93846664-93846686 ATATATATATATATATATGTAGG + Intergenic
1012050453 6:94335732-94335754 ATATATATATATATATATAGTGG + Intergenic
1012240122 6:96861503-96861525 ATATATATCCAGATATATACTGG - Intergenic
1012632832 6:101494983-101495005 ATATATATATATATATATGAAGG + Intronic
1012645566 6:101675185-101675207 ATATAAATAAAAATAAATGGAGG - Intronic
1012718248 6:102704388-102704410 AGATAGATACACATATGTGGAGG - Intergenic
1012842815 6:104351487-104351509 ATATATATATATATATATGAAGG - Intergenic
1013406027 6:109844586-109844608 ATATAGATATATATATTTTGTGG + Intergenic
1013422815 6:109981386-109981408 ATATAGATATAGATATACTATGG - Intergenic
1013657160 6:112257828-112257850 ATATAGATAATGTTAAATGGGGG - Intergenic
1013721166 6:113029974-113029996 ATATATATATATATATATGATGG + Intergenic
1013772819 6:113646458-113646480 ATATATATATATATATATGTAGG - Intergenic
1014154629 6:118096243-118096265 ATATGGACACAGATATATTTAGG + Intronic
1015067331 6:129046650-129046672 CTATAGATACAGATACATATAGG - Intronic
1015083444 6:129256782-129256804 ATATATATATATATATATAGTGG + Intronic
1015559812 6:134502619-134502641 ATTTAGATATAGAGATATAGAGG - Intergenic
1015646539 6:135396826-135396848 CTATAGATATGGATATATGTAGG - Intronic
1015696420 6:135985225-135985247 ATAAGGAAACAGCTATATGGAGG - Intronic
1015735479 6:136394927-136394949 ATATATATATATATATATGATGG - Intronic
1016919553 6:149278476-149278498 AAATTGATACAGGTATATGAAGG + Intronic
1017081256 6:150671084-150671106 ATATATATATATATATATGATGG - Intronic
1017447392 6:154519294-154519316 ATATATATATATATATATGTTGG + Intergenic
1017631787 6:156403093-156403115 ATATAGTAACAGACATATTGAGG - Intergenic
1018197550 6:161368391-161368413 ATATATATATATATATATGCTGG + Intronic
1018263818 6:161998434-161998456 ATTTACATGCAAATATATGGGGG - Intronic
1018279944 6:162174480-162174502 ATATAGAAATAGAAATATGCAGG - Intronic
1018523187 6:164676366-164676388 ATATAGTCAAAGATATATAGAGG - Intergenic
1020246042 7:6430265-6430287 ATATATATATATATATATGCAGG + Intronic
1020314669 7:6896910-6896932 ATATATATATATATATATGGTGG + Intergenic
1020385534 7:7597500-7597522 ATATATATATATATATATGAAGG + Intronic
1021055784 7:16044323-16044345 ATATAGATATAGATAGATAAAGG - Intergenic
1021273292 7:18618744-18618766 ATATATATATATATATATGTAGG + Intronic
1021999595 7:26213734-26213756 ATATATATATATATATAAGGAGG - Intergenic
1022397762 7:30006088-30006110 ATATATATACATATATATTTAGG + Intergenic
1022483870 7:30762660-30762682 ATATATATATAGATATATAAAGG - Intronic
1022755548 7:33284495-33284517 ATCATCATACAGATATATGGTGG - Intronic
1022826944 7:34024417-34024439 ATATATATATATATATATGTTGG + Intronic
1023035805 7:36130598-36130620 ATATAGATACATATGCCTGGGGG + Intergenic
1023502707 7:40867213-40867235 AGATAGAGACATATATATGGGGG - Intergenic
1025264603 7:57445845-57445867 ATATATATACACATATATATAGG + Intergenic
1025740858 7:64194306-64194328 ATATATACACATATATATGAAGG - Intronic
1026220054 7:68387927-68387949 ATGTACTTACTGATATATGGTGG - Intergenic
1026396254 7:69957561-69957583 TTATAGTTACATATATATTGGGG + Intronic
1026821162 7:73550223-73550245 TTATATTTACAGATACATGGAGG + Intronic
1027164755 7:75826410-75826432 ATATATATACGTATATATGAAGG - Intergenic
1027508513 7:79049560-79049582 AAATAGATACAGATGTATGTTGG - Intronic
1027582019 7:80009443-80009465 ATATATATACATATATATGTTGG + Intergenic
1027788670 7:82612458-82612480 ATATATATATATATATATGCTGG + Intergenic
1027987805 7:85316967-85316989 ATATATATATATATATATGAAGG + Intergenic
1028478606 7:91279222-91279244 ATATAGATTTATATATATGGAGG - Intergenic
1028699287 7:93758209-93758231 ATATATATATATATATATAGTGG + Intronic
1029657853 7:101939097-101939119 ATATATATATATATATATGATGG + Intronic
1030046528 7:105501974-105501996 ATATATATATATATATATAGGGG + Intronic
1030076951 7:105745262-105745284 GTATAGATACACATATATATAGG + Intronic
1030393784 7:108960448-108960470 ATATATATATATATATATAGAGG + Intergenic
1030505969 7:110422803-110422825 ATATAGTTAGAGGTATATGGTGG - Intergenic
1030763296 7:113378015-113378037 ATATATATACACATATATATAGG + Intergenic
1030852990 7:114514440-114514462 ATATAAATAGAGTAATATGGTGG - Intronic
1030936452 7:115590695-115590717 ATATATATATATATATATGATGG + Intergenic
1031429496 7:121650205-121650227 ATATAGATATATATATAAAGGGG + Intergenic
1031441026 7:121794721-121794743 ATATATATATATATATATGGGGG - Intergenic
1031475877 7:122221000-122221022 ATATATATATATATATATGGTGG - Intergenic
1031561475 7:123243926-123243948 AGATATATACAGATATTTAGGGG + Intergenic
1031812979 7:126395071-126395093 ATATAGATATAAATATATATAGG + Intergenic
1031833356 7:126652779-126652801 ATATATATACATATATAAAGGGG - Intronic
1031858581 7:126951858-126951880 ATATAGATAAAGAAATATAGAGG + Intronic
1031889912 7:127281918-127281940 AAATAGTTATAGATATATGAAGG + Intergenic
1031907470 7:127476407-127476429 ATATAGACACAGTGATCTGGAGG - Intergenic
1032212514 7:129928790-129928812 ATATATATACATATATAAAGAGG + Intronic
1032668121 7:134057861-134057883 AAATAGATCCAGATAGCTGGTGG + Intronic
1032671951 7:134091975-134091997 ATATATAAAGAGATATATTGGGG - Intergenic
1032899514 7:136291011-136291033 AGATAGATACAGATATAGGTAGG - Intergenic
1032960159 7:137023807-137023829 ATATACATAAAGATATATATGGG + Intergenic
1033182445 7:139194208-139194230 ATATATATATATATATATGATGG + Intergenic
1033628511 7:143134179-143134201 ATATATATATATATATATGATGG - Intronic
1033916970 7:146338095-146338117 ATGGATATACAGATATATGGGGG + Intronic
1033976267 7:147104869-147104891 ATATATATATATATATATGAGGG - Intronic
1033997673 7:147371870-147371892 ATATACATAAATACATATGGAGG + Intronic
1034808952 7:154113390-154113412 ATATATATATATATATATGTAGG - Intronic
1034930672 7:155160226-155160248 TTATAGATATAGATATATAGAGG - Intergenic
1034949372 7:155286708-155286730 GAATAGATACATATATATGAAGG - Intergenic
1034996197 7:155578547-155578569 AGATAGATGGAGATATATGAGGG - Intergenic
1035611415 8:967813-967835 ATATATATATATATATATAGTGG - Intergenic
1035707053 8:1683831-1683853 ATATATATATATATATATAGTGG - Intronic
1035777238 8:2197695-2197717 ATATAGATACAGATACAGATAGG - Intergenic
1035829357 8:2678048-2678070 ATATATATATATATATATGAAGG - Intergenic
1035839743 8:2797807-2797829 ATATATATATATATATATGTAGG + Intergenic
1036018740 8:4817106-4817128 ATTTATATACAGATACATGGAGG - Intronic
1036835960 8:12067195-12067217 ATAAACATACATATATATGCTGG - Intronic
1036857803 8:12313765-12313787 ATAAACATACATATATATGCTGG - Intergenic
1037051484 8:14379728-14379750 ATATATATACATATATATTTTGG + Intronic
1037135547 8:15455362-15455384 ATATACATACATATACATGATGG - Intronic
1037201477 8:16258450-16258472 ATATATACACACATATATGTTGG + Intronic
1037220508 8:16513669-16513691 ATATAGATATAAATAAATGAGGG + Intronic
1037278491 8:17208326-17208348 ATATAGATATATAGATATAGTGG + Intronic
1037278492 8:17208350-17208372 ATATAGATATATAGATATAGTGG + Intronic
1037399701 8:18482852-18482874 ATATATATATATATATATGATGG - Intergenic
1037470841 8:19208755-19208777 ATGTAGATTCATAAATATGGCGG + Intergenic
1038025878 8:23590359-23590381 ATATATATATATATATATGTTGG + Intergenic
1038030151 8:23631282-23631304 ATATATATATATATATATGATGG - Intergenic
1038172913 8:25154318-25154340 ATATATATATATATATATGATGG - Intergenic
1038212532 8:25532890-25532912 ATATAGATATAAATATATCTAGG - Intergenic
1038273907 8:26103235-26103257 ATAGATATACAGATAGATAGAGG + Intergenic
1038368650 8:26964510-26964532 ATATGGAGACAGATATATAGAGG - Intergenic
1038580659 8:28746639-28746661 ATATATTTACAAATATATTGGGG + Intronic
1038647186 8:29371709-29371731 ATATATATATATATATATGTAGG - Intergenic
1038675762 8:29621447-29621469 ATACAGAAGCAGATATATGGGGG + Intergenic
1038676020 8:29623606-29623628 ACATACATACATATACATGGGGG - Intergenic
1038917971 8:32048467-32048489 ATATATATATATATATATAGTGG + Intronic
1039056242 8:33539300-33539322 ATATATATATATATATATGCTGG + Intergenic
1039605821 8:38879661-38879683 ATATATATACATATATATATGGG + Intergenic
1039605831 8:38879769-38879791 ATATATATACATATATATATGGG + Intergenic
1039605833 8:38879795-38879817 ATATATATACATATATATATGGG + Intergenic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1040913918 8:52548879-52548901 ATATATGTACATATATATGTTGG + Intronic
1041749568 8:61245582-61245604 ATATAATTACAGATATACTGGGG + Intronic
1041765965 8:61418551-61418573 ACATAGATAAATAAATATGGTGG + Intronic
1041854134 8:62430345-62430367 AGATACATACATATATATTGTGG + Intronic
1042010386 8:64238505-64238527 ATCTACATACAGATATATGCTGG + Intergenic
1042061977 8:64828631-64828653 AGATATATACATATATATGTAGG + Intergenic
1042238452 8:66638978-66639000 ATATATATACATATATTTTGTGG + Intronic
1042500720 8:69505726-69505748 ATATAGAGACCTATATTTGGGGG + Intronic
1043100604 8:76040457-76040479 ATATATATATATATATATAGGGG + Intergenic
1043212951 8:77548810-77548832 ATATAGATGCAAGTAAATGGTGG - Intergenic
1043278773 8:78436610-78436632 ATATATATATATATATATGATGG + Intergenic
1043688873 8:83125338-83125360 ATATATATACACATATGAGGGGG + Intergenic
1043694185 8:83200014-83200036 ATATATATATGTATATATGGAGG - Intergenic
1043763411 8:84098402-84098424 ATATATATATATATATATGTTGG + Intergenic
1043781190 8:84337459-84337481 ATGTAGATACAATTATATTGTGG + Intronic
1044202740 8:89455405-89455427 ATATATACACATATATATGGAGG + Intergenic
1044351871 8:91176111-91176133 ATATATATATATATATATGAGGG - Intronic
1044497029 8:92898859-92898881 ATATATATATATATAGATGGGGG + Intronic
1044560013 8:93603653-93603675 ATAAATATACATATATTTGGGGG - Intergenic
1044568446 8:93691377-93691399 ATATAGTTACAGTTATATATAGG - Intergenic
1044769394 8:95614102-95614124 ATATACACACATATATATGATGG - Intergenic
1044953496 8:97456151-97456173 ATAGAGATAGAGATATAAAGGGG + Intergenic
1045274786 8:100693525-100693547 ATATATATATATATATATGAAGG + Intronic
1045696847 8:104818745-104818767 AAATAAATACAGAAATCTGGAGG - Intronic
1045841087 8:106582186-106582208 ATATATATATATATATATGAAGG + Intronic
1046152690 8:110249115-110249137 ATATATATATATATATATGATGG + Intergenic
1046215914 8:111146731-111146753 ATATATATATATATATATAGTGG + Intergenic
1046308788 8:112405210-112405232 ATATATATATATATATATGGGGG - Intronic
1046770726 8:118113711-118113733 ATATATATATATATATATGCTGG + Intergenic
1047281475 8:123449957-123449979 ATATATATATATATATATGCTGG + Intronic
1047469016 8:125148978-125149000 ATATAGCAACATATATATGTTGG + Intronic
1047965744 8:130045443-130045465 ATATAAATACATATAAATTGGGG - Intergenic
1048556349 8:135481219-135481241 ATATATATATATATATATCGTGG - Intronic
1048825926 8:138425960-138425982 ATATATATATATATATATGTTGG - Intronic
1049559642 8:143303063-143303085 ATATATATATATATATATGCTGG - Intergenic
1050003669 9:1105014-1105036 ATATAGATATATATATATACGGG - Intergenic
1050803579 9:9645446-9645468 ATATATATATACATATATGTAGG - Intronic
1050940893 9:11455300-11455322 ATATAAATACAGAGAAATGAAGG + Intergenic
1050975975 9:11938423-11938445 ATAGAGATACAGATAGATACAGG + Intergenic
1051034904 9:12732742-12732764 ATATACACACATATATATGAGGG + Intergenic
1051238067 9:15022914-15022936 ATATATATATATATATATGTAGG + Intergenic
1051794152 9:20845438-20845460 ATATATATATATATATATCGAGG - Intronic
1051865771 9:21680380-21680402 ATTCAGATACAGATCTATGAGGG - Intergenic
1051923045 9:22290441-22290463 ATATATATATATATATATGAAGG + Intergenic
1052032113 9:23640546-23640568 ATATACATATATATATATAGTGG - Intergenic
1052103164 9:24476432-24476454 ATATATATATATATATATGATGG + Intergenic
1052294007 9:26877251-26877273 ATATACATACTGATATCTTGGGG - Intronic
1052452429 9:28649382-28649404 ATATAGATACTAATTTATAGAGG + Intronic
1052895633 9:33745431-33745453 ATATATATATATATATATGATGG - Intergenic
1053401004 9:37822425-37822447 ATATATATATATATATATGATGG + Intronic
1053409756 9:37908023-37908045 ATATATATATATATATATGTTGG - Intronic
1053695564 9:40636330-40636352 ATATACATATATATATATGAAGG + Intergenic
1054768908 9:69066868-69066890 AAATATATATATATATATGGGGG + Intronic
1054950169 9:70841621-70841643 ATATATATATATATATATAGTGG - Intronic
1054950171 9:70841663-70841685 CTATATATACATATATATGGTGG - Intronic
1055612148 9:78033691-78033713 ATATACATACATATATTCGGAGG - Intergenic
1055831926 9:80389978-80390000 ATATACATATATATATATGGAGG + Intergenic
1055922119 9:81472072-81472094 ATATATATATATATATATAGCGG + Intergenic
1056841183 9:89999194-89999216 ATATATATACATATATATTGAGG - Intergenic
1057120416 9:92567392-92567414 ATATAGATATATATATAAAGTGG + Intronic
1057240836 9:93407143-93407165 ATATAGATATAGATAGATATAGG + Intergenic
1058257048 9:102779552-102779574 ATATATATATATATATATGTTGG + Intergenic
1058285686 9:103175270-103175292 GTATATATACAGGTATATGTTGG + Intergenic
1059603898 9:115812236-115812258 ACATATATACAGACATATTGTGG - Intergenic
1059633539 9:116151094-116151116 ATATATATATATATATATGAAGG + Intergenic
1059642478 9:116231077-116231099 ATATATATATAGATATATAACGG + Intronic
1060066658 9:120507951-120507973 ATATATATATATATATATAGTGG + Intronic
1060374156 9:123103619-123103641 ATATATATATATATATATAGTGG + Exonic
1060715376 9:125922481-125922503 ATATAAATACAGATATACTGTGG - Intronic
1061156517 9:128865304-128865326 ATATATATATATATATATGTAGG - Intronic
1061656515 9:132095417-132095439 ATATATATATATATATATGATGG - Intergenic
1202778009 9_KI270717v1_random:9946-9968 ATATACATATATATATATGAAGG + Intergenic
1202794639 9_KI270719v1_random:110118-110140 ATATATATACACATATATATTGG + Intergenic
1202799105 9_KI270719v1_random:157361-157383 GTATATATACATATATATGTGGG + Intergenic
1185587495 X:1250753-1250775 ATATCTATATAGATATATAGAGG + Intergenic
1185671684 X:1814881-1814903 ATATATATATATATATATGGAGG + Intergenic
1185819493 X:3188109-3188131 ATAGATATATAGATATATAGAGG - Intergenic
1185921619 X:4099267-4099289 AGATAGATACAGATTTATTATGG - Intergenic
1185972868 X:4684205-4684227 ATATATATATATATATATGGTGG - Intergenic
1186080500 X:5925821-5925843 ATATATATATATATATATGGTGG - Intronic
1186101270 X:6159054-6159076 AATAAAATACAGATATATGGAGG + Intronic
1186130062 X:6456652-6456674 ATATGTATATATATATATGGGGG + Intergenic
1186157563 X:6741512-6741534 AGATAGATATAGATATATAGAGG + Intergenic
1186343618 X:8668390-8668412 ATATATATATATATATATGATGG - Intronic
1186343625 X:8668527-8668549 ATATATATATATATATATGATGG + Intronic
1186997142 X:15135709-15135731 ACATACATACATATATATGATGG + Intergenic
1187094629 X:16134408-16134430 AAATAGAAACAGATTTATAGAGG - Intronic
1187959740 X:24557364-24557386 AGCTAGACACAGATAGATGGGGG - Intergenic
1187971813 X:24666352-24666374 ATATATGTAAAGATATATGTAGG + Intronic
1188026125 X:25211160-25211182 ATATATATATATATATATAGTGG - Intergenic
1188049847 X:25471386-25471408 ATATATATATATATATGTGGGGG - Intergenic
1188049849 X:25471388-25471410 ATATATATATATATATATGTGGG - Intergenic
1188165455 X:26857254-26857276 ATTTAAATACAGATATAAGAGGG - Intergenic
1188169642 X:26909048-26909070 ATATATATATATATATATGTAGG - Intergenic
1188280630 X:28263596-28263618 ATATATATACATATATATATAGG - Intergenic
1188338090 X:28963391-28963413 AAATTGATATAGATATATTGGGG - Intronic
1188758754 X:33999012-33999034 ATATATATATATATATATGATGG - Intergenic
1188815862 X:34713447-34713469 ATATAGTTTCAAATATAGGGAGG + Intergenic
1189130974 X:38497907-38497929 ATATATATATATATATATGATGG + Intronic
1189155936 X:38756889-38756911 ATAAAGATCCAGAGATATTGAGG + Intergenic
1189489780 X:41461378-41461400 ATATATATATATATATATGACGG - Intronic
1189764723 X:44358785-44358807 ATATATATACATATATATAATGG + Intergenic
1189970777 X:46416037-46416059 ATATATATATATATATATGGTGG - Intergenic
1190555515 X:51630580-51630602 ATATATATATATATATATGTAGG + Intergenic
1190636356 X:52438370-52438392 ATATATATACATATATATATAGG - Intergenic
1190719630 X:53136689-53136711 ATATATATATATATATATGCCGG - Intergenic
1190883344 X:54509278-54509300 AAATAAATAAAGATATATAGAGG - Intergenic
1190970325 X:55342207-55342229 AGATAGCTACAGATAAAAGGTGG - Intergenic
1190996345 X:55613863-55613885 ATATGGATACATATATATAAAGG + Intergenic
1190996364 X:55614282-55614304 ATATATATACACATATATAAAGG - Intergenic
1191175675 X:57498672-57498694 ATATATATATATATATATGATGG - Intergenic
1191615022 X:63161589-63161611 ATATATATGCATATATATGTGGG - Intergenic
1191651894 X:63548110-63548132 ATATAGATTCATATATATTAAGG + Intergenic
1191777992 X:64838632-64838654 ATATATATATATATATATGATGG - Intergenic
1191944832 X:66521548-66521570 ATATATATATATATATATGATGG - Intergenic
1192014016 X:67308862-67308884 ATATATATATATATATATGATGG - Intergenic
1192140346 X:68641928-68641950 ATATATATATATATATATGAAGG - Intergenic
1192387932 X:70692630-70692652 ATACAGATACATATATATGATGG - Intronic
1192566827 X:72171472-72171494 ATATACATACATATATATCCTGG + Intergenic
1192657556 X:73007776-73007798 ATATATATATATATATATGTAGG - Intergenic
1192821444 X:74649797-74649819 ATATACATATATATATATGAAGG - Intergenic
1192968862 X:76209334-76209356 ATATATAGATAGATATATGATGG - Intergenic
1193063054 X:77226914-77226936 ATATATATATATATATATGATGG + Intergenic
1193102114 X:77626067-77626089 ATATATATATATATATATGATGG + Intronic
1193158078 X:78195741-78195763 ATATATATATATATATATGATGG + Intergenic
1193798808 X:85911219-85911241 ATATATATATATATATATGAAGG + Intronic
1194031176 X:88817544-88817566 ATATACATATATATATATGATGG + Intergenic
1194280455 X:91946554-91946576 ATATATATATATATATATGAGGG - Intronic
1194393951 X:93356569-93356591 ATATATATATATATATATGATGG - Intergenic
1194433460 X:93839677-93839699 ATATATATATATATATATGAAGG - Intergenic
1194584502 X:95716331-95716353 ATTTAGATGCACATACATGGTGG + Intergenic
1194656815 X:96583243-96583265 ATATATATATAAATATATGGTGG - Intergenic
1194868992 X:99103912-99103934 ATATATATATATATATATGTGGG + Intergenic
1194868994 X:99103914-99103936 ATATATATATATATATGTGGGGG + Intergenic
1194907871 X:99601099-99601121 ATATAGACATAGATAGATGATGG - Intergenic
1195015431 X:100775009-100775031 ATATATATACATGTATATGATGG + Intergenic
1195091853 X:101468055-101468077 ATATAGATACAGGCATATATGGG + Intronic
1195404326 X:104496304-104496326 ATATGGATTCACATATATGGAGG + Intergenic
1195901873 X:109807466-109807488 ATATATATATATATATATAGGGG - Intergenic
1195984722 X:110616349-110616371 ATATATATATATATATATGATGG - Intergenic
1196083173 X:111655181-111655203 ATATATGTATATATATATGGGGG + Intergenic
1196291013 X:113941097-113941119 ATATACATAATGATATATGTTGG + Intergenic
1196340395 X:114588444-114588466 ATTTAAATACCCATATATGGTGG - Intronic
1196478513 X:116117157-116117179 ATATATACACATATATATGATGG + Intergenic
1196526779 X:116737473-116737495 ATATATATATAAATATATGTTGG - Intergenic
1196865076 X:120063770-120063792 ATATATATATATATATATGGAGG + Intergenic
1196878025 X:120172564-120172586 ATATATATATATATATATGGAGG - Intergenic
1196878027 X:120172587-120172609 ATATATATATATATATATGGAGG - Intergenic
1197103322 X:122682639-122682661 ATATATATATATATATATGTGGG - Intergenic
1197418815 X:126210671-126210693 ATATATATACACATATATATCGG + Intergenic
1197475863 X:126924088-126924110 ATATATATATATATATATGATGG - Intergenic
1197599630 X:128513118-128513140 ATATATACACATATATATGATGG + Intergenic
1197659420 X:129154074-129154096 ATATATATACATATATATATGGG - Intergenic
1197659422 X:129154100-129154122 ATATATATACATATATATATGGG - Intergenic
1197659424 X:129154126-129154148 ATATATATACATATATATATGGG - Intergenic
1198172065 X:134117040-134117062 ATATATATATATATATATGAGGG + Intergenic
1198210712 X:134513091-134513113 ATATACATACATATACATCGGGG - Intronic
1198343302 X:135735663-135735685 ACATACATATATATATATGGGGG - Intergenic
1198763668 X:140059922-140059944 ATATATATATATATATATGGTGG - Intergenic
1198772154 X:140141957-140141979 ATATAGATATTTATATATGTAGG - Intergenic
1199023979 X:142916335-142916357 ATATATATATATATATATGTAGG - Intergenic
1199535426 X:148897218-148897240 ATATATATATATATATATAGTGG - Intronic
1199870388 X:151893206-151893228 ACATAGAGACAGAGATAGGGAGG - Intergenic
1200245202 X:154519929-154519951 ATATATATATATATATATGCAGG - Intergenic
1201193340 Y:11468238-11468260 ATATATATATATATATATGAAGG + Intergenic
1201241317 Y:11959370-11959392 ATATATATATATATATATGGCGG + Intergenic
1201257350 Y:12122053-12122075 ATATAGATTGATATATATGATGG + Intergenic
1201286680 Y:12384861-12384883 AAGTAGATAGAGATATCTGGTGG + Intergenic
1201365398 Y:13200376-13200398 ATACAGAGAAAGATATATTGAGG + Intergenic
1201587695 Y:15579401-15579423 ATATAGATATACAGATATAGGGG + Intergenic
1201671482 Y:16526443-16526465 ATAGAGATAAAGATATAGGTTGG + Intergenic
1201714215 Y:17026175-17026197 ATATATATATATATATATAGTGG - Intergenic
1201714216 Y:17026201-17026223 ATATATATATATATATATAGTGG - Intergenic
1201714217 Y:17026227-17026249 ATATATATATATATATATAGTGG - Intergenic
1201714232 Y:17026473-17026495 ATATATATATATATATATAGTGG + Intergenic
1202188097 Y:22209522-22209544 ATATACACACACATATATGTTGG + Intergenic
1202188099 Y:22209582-22209604 ATATATATATATATATATGTTGG + Intergenic
1202585413 Y:26419884-26419906 ATATAAATATATACATATGGAGG - Intergenic