ID: 1076367917

View in Genome Browser
Species Human (GRCh38)
Location 10:129934225-129934247
Sequence TCTGGGGTCTTCAAGGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076367917_1076367924 -4 Left 1076367917 10:129934225-129934247 CCTCCACCCTTGAAGACCCCAGA 0: 1
1: 0
2: 2
3: 29
4: 214
Right 1076367924 10:129934244-129934266 CAGAGACCCTCCCCACTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076367917 Original CRISPR TCTGGGGTCTTCAAGGGTGG AGG (reversed) Intronic
900403549 1:2482723-2482745 TCTGGGGTGGCCAGGGGTGGTGG - Intronic
900520364 1:3102401-3102423 TCTGGGGTCCTCATGGGCTGGGG + Intronic
900717364 1:4153487-4153509 CATGGGGTCCTCAAGGGAGGTGG + Intergenic
900799693 1:4729507-4729529 TATGGGGTCTTCCAGTCTGGAGG + Intronic
901053356 1:6437025-6437047 TCTGGGGTATTCCAAGCTGGAGG + Intronic
901435077 1:9242627-9242649 TCTGCAGTCTTCTGGGGTGGGGG + Intronic
902480920 1:16711138-16711160 TCTGGGGTATTCCAAGCTGGAGG - Intergenic
903068570 1:20715342-20715364 TCTGGGTTCTGAAAAGGTGGTGG - Intronic
904462249 1:30686985-30687007 TCTGGGGGCTTCCAGGGAAGGGG + Intergenic
906075055 1:43046022-43046044 TCTGGGCTCTGCAAAGGTAGAGG + Intergenic
906131984 1:43465752-43465774 TCTAGGGCCTACAAGGGTGATGG + Intergenic
908406339 1:63817638-63817660 TTTGGGGGCTGCAAGGGTGCAGG + Intronic
908643201 1:66247839-66247861 GCTGGGGTCTCCAAGGGTTTTGG + Intronic
909139578 1:71846542-71846564 TCTGGGTTCTTCAAGGGTATGGG - Intronic
911370883 1:96993525-96993547 TCTGGAATCTTCAAGGGGTGGGG - Intergenic
912731670 1:112112354-112112376 ACTGGGGTCCTCAAGGTTGCAGG + Intergenic
913447991 1:118970320-118970342 TGTGGGTTCTGCAGGGGTGGTGG - Intronic
913569805 1:120109355-120109377 TCTGCGATCTTCACGGGTGGTGG + Intergenic
914290614 1:146270321-146270343 TCTGCGATCTTCACGGGTGGTGG + Intergenic
914551658 1:148721104-148721126 TCTGCGATCTTCACGGGTGGTGG + Intergenic
915118513 1:153614700-153614722 TCTGGGGAGCTCATGGGTGGAGG - Exonic
915562041 1:156693137-156693159 TCTGGAGGCTTCAAGTGTGGTGG - Intergenic
916005308 1:160654227-160654249 TCTGGGGTCTGGAAGGATGGAGG - Intergenic
918096171 1:181335883-181335905 TCTGTGGTGCTCTAGGGTGGGGG - Intergenic
918597313 1:186307668-186307690 TGTGGGCTCCTCAGGGGTGGTGG - Exonic
919449804 1:197757430-197757452 CCTGGGGTCTGCTAGGGTTGAGG - Intronic
922325625 1:224525675-224525697 TCTGTGGTGTTCAAGGGTCAGGG + Intronic
924537077 1:244944860-244944882 TCTGGGGTTTTTTTGGGTGGGGG - Intergenic
924884567 1:248200439-248200461 TCTGGGATCTTCAGTGTTGGGGG - Intergenic
924894956 1:248326790-248326812 TCTGGGATCTTCAGTGTTGGGGG + Intergenic
1062958605 10:1556750-1556772 TCTGGGGTCTTCCTGGGGGCCGG - Intronic
1063441665 10:6077965-6077987 TCTGGGCTCTGCAGGGCTGGAGG - Intergenic
1065557483 10:26931349-26931371 TCTGGGTCGTCCAAGGGTGGTGG + Intergenic
1066276329 10:33872030-33872052 TCTGGGGTTTCTAAGGGTGAGGG + Intergenic
1069834121 10:71297894-71297916 GCAGGTGTCTGCAAGGGTGGGGG - Exonic
1070664886 10:78336033-78336055 TCTGGGGTCAGCCAGGATGGAGG + Intergenic
1072185909 10:93038801-93038823 TTTGAGTTCTTCAAGGGTAGAGG - Intronic
1072454031 10:95561020-95561042 TCTGGGGGCTTCCAGGGTTGGGG - Intronic
1072569269 10:96644096-96644118 TCAGCGGTTCTCAAGGGTGGTGG + Intronic
1072794376 10:98343253-98343275 CCTGGGGTCTTCAAGCTTGATGG + Intergenic
1075212127 10:120500322-120500344 TCTGGGGTCTCACAGAGTGGGGG + Intronic
1075617030 10:123897581-123897603 ACTGGGGTGGTCATGGGTGGGGG + Intronic
1076367917 10:129934225-129934247 TCTGGGGTCTTCAAGGGTGGAGG - Intronic
1078799064 11:14624518-14624540 TCTGGGCTCTGCAGGGCTGGAGG + Intronic
1081264918 11:41008665-41008687 TGTGGTGTCTTCAAGGTGGGAGG - Intronic
1086972857 11:93102313-93102335 ACTGGGGTTTTTAGGGGTGGGGG - Intergenic
1087058082 11:93952813-93952835 ACTGGGGGCTGCAAGGGTTGGGG + Intergenic
1087424053 11:97967381-97967403 TATAGGGGCTTCAAGGGTGTTGG + Intergenic
1088325081 11:108593162-108593184 TCTGGGGTCGGGCAGGGTGGGGG - Intronic
1089130617 11:116208968-116208990 TCTGGGGCCCTCAGGGGTGCAGG - Intergenic
1091232881 11:133999794-133999816 GCAGGGGTCTTCAAGGCTAGAGG + Intergenic
1092166979 12:6348345-6348367 TCGGGGGTCTTCAGGGATGAAGG - Intronic
1092203170 12:6599879-6599901 TGTCGGGTCTGCAAGGATGGTGG - Exonic
1093222328 12:16437482-16437504 TCTGCAGTCTTCATGGGTGCTGG + Intronic
1094828104 12:34287583-34287605 TATGGGGTATTCAGGGGTCGTGG + Intergenic
1095796588 12:46225728-46225750 TCTGCTGTCTTCAAGAATGGGGG - Intronic
1096101323 12:48971991-48972013 TCTGGGGTCGCCAAGGCTGCAGG + Intergenic
1101921810 12:108939037-108939059 TGTGGGGTCTTTAAGAGTGGGGG + Intronic
1107297699 13:38929875-38929897 GCTGGGGTCTTCAAAGGTACTGG + Intergenic
1107770369 13:43782974-43782996 TCTGGGCTCTTTAAGGTTTGTGG - Intronic
1109130137 13:58574677-58574699 TCTGGGGTCTTGGAGGAGGGTGG + Intergenic
1110672701 13:78200238-78200260 TCCAGGGCCTTCAAGGGAGGTGG - Intergenic
1114410637 14:22497291-22497313 TCTGTGGGGTTCAAGGGTGAAGG - Intergenic
1115868493 14:37774663-37774685 TCTGTGTTCATCAAGGGTGTTGG + Intronic
1117561277 14:56941930-56941952 ACTGGGGTCTTTCAGGGTGAGGG - Intergenic
1118906883 14:70029740-70029762 TCTGGGCTCCTCAGGGGTGAAGG + Intronic
1119883090 14:78117003-78117025 TCTGGGGTCATCAAGGGGTAAGG - Intergenic
1120562851 14:86018128-86018150 TCAGAGGTCTTCAAGGATGCTGG + Intergenic
1121807798 14:96846924-96846946 TTTGGTGTCTTGAGGGGTGGGGG + Intronic
1122136346 14:99635132-99635154 GTTGGGGTCTGCAGGGGTGGAGG + Intergenic
1123642278 15:22408554-22408576 TGGGGGGTCTTCATGGGGGGGGG - Intergenic
1124554371 15:30711304-30711326 TCTGGGCTTGTGAAGGGTGGAGG + Intronic
1124676875 15:31694373-31694395 TCTGGGCTTGTGAAGGGTGGAGG - Intronic
1128161746 15:65427300-65427322 TATGGGGTGTTCCAGGGTGGTGG + Intergenic
1128497315 15:68205955-68205977 TCTGAGGACTTTAAGGGTGGTGG + Intronic
1128637986 15:69315429-69315451 CCTTGGGTCTTCAAGGATGCTGG - Intronic
1129606599 15:77028161-77028183 GCTGGGGACTCCAGGGGTGGAGG + Intronic
1129784967 15:78304048-78304070 TCTGGGGTCCACGAGGGTGCAGG - Intergenic
1132580152 16:680895-680917 CCTGGGGTCCTCAAGGGTCGAGG - Intronic
1132630629 16:915611-915633 ACTGGGGTCGCCAAGGCTGGTGG - Intronic
1132886403 16:2184159-2184181 TCTGGGATCTCCACCGGTGGGGG + Intronic
1132933263 16:2469230-2469252 TCTGGTGGCTTCTGGGGTGGGGG - Intergenic
1133712858 16:8418209-8418231 ACTGGGGTCTACATGAGTGGAGG + Intergenic
1133850803 16:9501528-9501550 CCTGGTGTCTTCCAGAGTGGAGG + Intergenic
1138542263 16:57695636-57695658 TCTGGGGTCCTGAATGGTGTTGG + Intronic
1139590108 16:67928659-67928681 TCTGGTGTCTGCATGGGTGTTGG + Exonic
1140076001 16:71699368-71699390 TCTGGGGTCTTCATGGGCACAGG - Intronic
1141443921 16:84046129-84046151 TCTGGAGTTTTCTGGGGTGGTGG - Intergenic
1141535707 16:84678367-84678389 ACTGCAGTCTTGAAGGGTGGGGG - Intergenic
1141639888 16:85334982-85335004 TCTGGGGCTTCCAGGGGTGGCGG - Intergenic
1141918829 16:87121090-87121112 TCTGAGACCTTCAAGGGAGGTGG + Intronic
1141923170 16:87149951-87149973 TGTGGCTTCTTCAATGGTGGGGG + Intronic
1143584353 17:7843970-7843992 TCTGGGTTCTTTAAGGGAGTGGG + Intronic
1143738650 17:8935121-8935143 TCTGGGAGCTGAAAGGGTGGGGG - Intronic
1145940983 17:28743465-28743487 TGTGGTGTCTTCAAGGGTGGGGG + Intergenic
1146071074 17:29682276-29682298 TATAGGGTTTTCAAGGGAGGGGG + Intronic
1147798483 17:43063829-43063851 TCTGAGGTGTTAAAGGGAGGAGG + Intronic
1148804944 17:50259294-50259316 ACTGGGCTCTGCAAGGGTGTTGG - Intergenic
1149173299 17:53839762-53839784 TCTTGGGACTTCAAGAATGGAGG - Intergenic
1151406414 17:73890010-73890032 TCTGGAGTCCTCCAGGCTGGAGG - Intergenic
1151806733 17:76410357-76410379 TCGGTGGTCATAAAGGGTGGTGG + Intronic
1151886497 17:76925986-76926008 TCTGCTGTCTCCAGGGGTGGAGG - Intronic
1152009314 17:77701250-77701272 TCTTGGCACTGCAAGGGTGGAGG - Intergenic
1155095087 18:22548041-22548063 TCAGGGGTCTTCCACTGTGGCGG - Intergenic
1157492053 18:48130342-48130364 TCTGGGGGCTTTAAGGGAAGTGG + Intronic
1157717373 18:49897265-49897287 TCTGGGGTCTCCGAGGGTGTGGG - Intronic
1158589382 18:58767069-58767091 TCTGGGGTGGTCATGAGTGGGGG + Intergenic
1159749768 18:72285799-72285821 TCTGGGGTCTGCGAAGGTTGAGG + Intergenic
1160177046 18:76603456-76603478 TTTGAGGACTTCAAAGGTGGTGG + Intergenic
1161101673 19:2424712-2424734 TCTGGGCTCTGCAGGGCTGGAGG + Intronic
1161528591 19:4773015-4773037 TCTGGGGTCCTCAATGGAGGAGG + Intergenic
1162193058 19:8962157-8962179 TGTGGTGTCTTCCATGGTGGAGG + Exonic
1162567902 19:11454176-11454198 TCGGGGGTGGTCGAGGGTGGGGG + Exonic
1163554489 19:17984427-17984449 TCTGGGGTGTTCAAGGTCAGAGG - Intronic
1166181418 19:41111900-41111922 TCTTGGGCCTTCATGGGTGGTGG - Intergenic
1166718980 19:44986745-44986767 CCTGGGGTCCCCAGGGGTGGTGG - Intronic
1167984115 19:53300686-53300708 TCTGTGCCCTTCATGGGTGGGGG - Intergenic
1168284342 19:55322958-55322980 TCCTGGGTCCCCAAGGGTGGAGG - Intronic
1168313556 19:55473615-55473637 TCTGGGGCCTGCAGGGGTGCAGG + Intergenic
1202714957 1_KI270714v1_random:37043-37065 TCTGGGGTATTCCAAGCTGGAGG - Intergenic
925149948 2:1608115-1608137 AGTGGTGTCTCCAAGGGTGGAGG - Intergenic
928457761 2:31438795-31438817 TCTGGGGTGTTGTGGGGTGGGGG + Intergenic
930096725 2:47571231-47571253 TCTGAGGTCTCCAGGGCTGGAGG + Intergenic
932812666 2:74837352-74837374 TCTGTGGTCATGATGGGTGGGGG - Intronic
934310144 2:91855380-91855402 TCTGCGTTCATCAAGGGTGTTGG - Intergenic
936010564 2:108922659-108922681 TCTGGCTCCTTCAAGGGTGGAGG - Intronic
936231117 2:110700330-110700352 TCTGGGGTCTCCAGGAGTGAGGG + Intergenic
937230763 2:120396930-120396952 CCTGGGGCCTGCACGGGTGGGGG - Intergenic
938694907 2:133826277-133826299 CCTGGGGTCCTTAAGGATGGGGG + Intergenic
940890480 2:159030917-159030939 GCTGAGGTCTTCAGGGCTGGTGG + Intronic
941721996 2:168822053-168822075 TCTGAGTTCATCAAGGGTGATGG + Intronic
941848779 2:170158531-170158553 TCTGGGCTTTTCCTGGGTGGTGG + Intergenic
945660271 2:212677494-212677516 TCTGGGTGCTTCAATGTTGGGGG + Intergenic
947118000 2:226791840-226791862 TCTCGGGTCATCCAGGGCGGTGG - Intronic
947727968 2:232411445-232411467 TCTGGGGCCTGGGAGGGTGGAGG + Intergenic
948402593 2:237694458-237694480 TTGGGGGTCATCATGGGTGGGGG + Intronic
948545228 2:238723353-238723375 TCAGTGGTCTTCAATGCTGGAGG - Intergenic
948787164 2:240358670-240358692 CCTGGGGTCCTCTGGGGTGGTGG + Intergenic
1169198651 20:3697041-3697063 CCTGGGGACTTGGAGGGTGGAGG - Intronic
1170199994 20:13732135-13732157 ACTGGTGTCTGAAAGGGTGGAGG + Intronic
1172736506 20:37129902-37129924 CCTGGGGACTTCAGGGGTGGGGG - Intronic
1173911987 20:46677342-46677364 TCTGGGGACTTCTAGGGGGATGG - Intronic
1174705010 20:52646566-52646588 TCTGTGGTCTTTAAGGGGTGGGG + Intergenic
1174976225 20:55338552-55338574 TCTGGAGTCTCCCAGGGTGGTGG + Intergenic
1175960521 20:62634304-62634326 AGTGGGGTCCTCAAGGGAGGGGG + Intergenic
1177784515 21:25656465-25656487 TTTGGGGTCTTCAAGGCTAAAGG - Intronic
1178976753 21:37227152-37227174 TCTGGGGTTTTCACGGGTCCTGG + Intronic
1179507686 21:41852684-41852706 TCTGGGGCCTGCAGCGGTGGCGG - Intronic
1180626876 22:17199444-17199466 CCTGGGATCTTCGTGGGTGGAGG - Intronic
1180708777 22:17825721-17825743 TTTGGTGTCTTCATAGGTGGTGG + Intronic
1181110599 22:20600653-20600675 TCTGGGGACTTCTAGGAGGGAGG - Intergenic
1182548649 22:31089748-31089770 GCTGGTGCCTTCAGGGGTGGGGG - Exonic
1183056636 22:35310795-35310817 TGTGAGCTCTTTAAGGGTGGCGG - Intronic
1183291498 22:37004396-37004418 GCTAGGGTCTCCTAGGGTGGTGG - Intronic
1183500504 22:38175932-38175954 TCTGGGGGCTTCAGAGGTGCTGG - Intronic
1184095740 22:42315325-42315347 TCTGGGGTCCTCATGGCAGGTGG + Intronic
1185030570 22:48440872-48440894 TCTGGGGTCCTCAAGACTGGAGG - Intergenic
1185345352 22:50308276-50308298 CCTGCGGCCTTCAGGGGTGGGGG + Intergenic
949901607 3:8819540-8819562 TCAGGGGTCTTCAAGTGAAGAGG + Intronic
949982182 3:9508807-9508829 TCTGGGGACTCCGAGGGCGGGGG - Intronic
951842232 3:27046866-27046888 TCTGGTGTCATCAAGGTTGGAGG - Intergenic
952326028 3:32321478-32321500 TCTGGGGGGTCCTAGGGTGGGGG - Intronic
952915460 3:38235637-38235659 TCTGTAGTCTTCCAGGGAGGGGG + Intronic
953492751 3:43364475-43364497 TCTGGAGTCCTCAGGGGTGTCGG + Intronic
954449772 3:50565556-50565578 TCTGGTGTCATTAAAGGTGGTGG + Exonic
956884989 3:73550236-73550258 TCTGGGGGGTTGAGGGGTGGCGG - Intronic
957600737 3:82332870-82332892 TCTGGGGTTTTCCAGGCTGTAGG + Intergenic
968983079 4:3861203-3861225 TGTTGGGTCTTCAACGGAGGAGG - Intergenic
969052757 4:4385115-4385137 TCTTGGGTCTTCACTGGTGCTGG - Exonic
975746761 4:77482460-77482482 TCTGGGCTCTGCAAGGTTAGAGG + Intergenic
976212090 4:82681615-82681637 CCTGGGGCTATCAAGGGTGGAGG + Intronic
976725413 4:88211368-88211390 ACTGGGGTCTCCAAAAGTGGGGG - Intronic
977926385 4:102705245-102705267 CCTGGGGGCTGCGAGGGTGGAGG - Intronic
979099024 4:116591557-116591579 TTTAGTGTTTTCAAGGGTGGAGG + Intergenic
979307955 4:119169707-119169729 TATAGGGTCTTCCAGGGAGGAGG + Intronic
979875669 4:125887881-125887903 TCTGGTGTCTACAAGGATAGTGG - Intergenic
981039676 4:140211588-140211610 TCTGTGATCTTCAAGGTTGGAGG - Intergenic
981472654 4:145154316-145154338 TCTGGGGTATTTAAAGGTGAGGG - Intronic
981499956 4:145439311-145439333 TCTGGCCTCTGCAAGGCTGGAGG + Intergenic
982138640 4:152296405-152296427 TCTGGGGTCCTGGAGGTTGGTGG + Intergenic
983012480 4:162564630-162564652 TCTGGGCCTGTCAAGGGTGGTGG + Intergenic
983615369 4:169698439-169698461 TCTGTGGTTTTCTAGGGTGGTGG + Intronic
987614775 5:20259424-20259446 TCTTGGGGCCTCAGGGGTGGCGG - Intronic
987899208 5:23989127-23989149 TCTGGCCTATTAAAGGGTGGAGG - Intronic
992268591 5:75042711-75042733 TCTGGGTTCTTCCAATGTGGTGG + Intergenic
995259115 5:110081439-110081461 TCAGGGGTCTTCAAGGATGGTGG - Intergenic
996706315 5:126502068-126502090 CCTGGGGTCTTTACGGGTGCAGG + Intergenic
996830255 5:127732827-127732849 ACTGGGGCCTGCAAGGGTGAGGG + Intergenic
996904640 5:128584217-128584239 TCTGGGATTTTGAAGGCTGGTGG + Intronic
997608084 5:135191206-135191228 CCTGGGGTCTGCGGGGGTGGGGG + Intronic
998147014 5:139734735-139734757 TCTGGGGTGGGCAAGGGTGAGGG - Intergenic
998370791 5:141659720-141659742 TCTGGGTCCTGCAAGGGTAGGGG + Intronic
999303039 5:150502792-150502814 TCTGGGGTAGGCAAGGTTGGGGG + Intronic
1003420104 6:5949674-5949696 TCTGGGGGCTTCCATGTTGGTGG + Intergenic
1006740181 6:36302363-36302385 CCTGGGGCCTTCAACTGTGGGGG + Exonic
1006915051 6:37588530-37588552 GCTGGGGCCTGCAGGGGTGGAGG - Intergenic
1007803866 6:44422298-44422320 TCTGGGGTCATTGAGTGTGGTGG + Intronic
1007952206 6:45882400-45882422 CTTGAGGTTTTCAAGGGTGGTGG - Intergenic
1008538061 6:52522530-52522552 TCAGGGGTCATGAAGGTTGGAGG - Intronic
1010004516 6:70981058-70981080 TCTGGGATCTTCATACGTGGTGG + Intergenic
1016205787 6:141466830-141466852 TCTTGGGTCTTTAAAGGTGCAGG + Intergenic
1018519832 6:164635566-164635588 TCTGGGGTCCTCAGTGGTGAAGG + Intergenic
1019309438 7:353063-353085 TATGGGGTCTTCAGGGGGTGGGG + Intergenic
1021274530 7:18633270-18633292 TCTGAGGCCTTCAAGTGTGGTGG + Intronic
1022548171 7:31208631-31208653 TCAGGGGCTTTCAAGGGTGCTGG + Intergenic
1025854340 7:65264740-65264762 TCTGGGGTCCTCAGTGCTGGCGG + Intergenic
1028441029 7:90861112-90861134 TCTGGGGTCCTCAGGGGTTGGGG - Intronic
1031997676 7:128243348-128243370 TCTGGGGTGCTCCAGGCTGGGGG + Intronic
1032085382 7:128880895-128880917 TATGGGGTCTTTAAGGGTCAGGG - Intronic
1032322412 7:130897363-130897385 TCTGGGCTGTTTCAGGGTGGCGG + Intergenic
1032482607 7:132258691-132258713 TCTGGGGTCTGGATGGGTGTGGG - Intronic
1034483221 7:151339688-151339710 TCTGAGATCTGCTAGGGTGGTGG - Intergenic
1035990267 8:4482250-4482272 ACTGGGGGCTATAAGGGTGGAGG - Intronic
1036558705 8:9883678-9883700 TCTGGGTTCTGCAGGGTTGGAGG + Intergenic
1038577837 8:28720602-28720624 TCAGGAGTGTTCAAGGGTGGTGG - Intronic
1042315319 8:67420489-67420511 TCTGGGGTGTTGGAGGGTGGGGG - Intergenic
1045390331 8:101708782-101708804 TCTGGGATCTTGAGGGGTGGAGG - Intronic
1045390429 8:101709614-101709636 TCTGGCATCTTGAGGGGTGGAGG - Intronic
1047339090 8:123962951-123962973 TCTGGGGTCCCCTTGGGTGGGGG + Intronic
1048209243 8:132441147-132441169 TTTGAGGTCTTCAAGTGTTGGGG - Intronic
1049021718 8:139961632-139961654 TCTGGGGCCCCCAAGGGTGCAGG - Intronic
1049729059 8:144166648-144166670 ACTGGGGTGTTGATGGGTGGAGG + Intronic
1051631964 9:19148748-19148770 TCTGGGCTCTTCAAGAGCAGGGG - Intronic
1052158562 9:25226410-25226432 TCTGGAGTCCCAAAGGGTGGAGG + Intergenic
1052903720 9:33816921-33816943 TCTGGGATCTTTATGGGCGGGGG + Intergenic
1053026602 9:34734638-34734660 TCTGGGGCCTACAAAGGTAGAGG - Intergenic
1053026609 9:34734664-34734686 TCTGGGGCCTACAAAGGTAGAGG - Intergenic
1053056826 9:34997949-34997971 TCAGGAGTGTTCAAGGGTGGAGG + Exonic
1054824462 9:69558735-69558757 ACTGGGGTCTGTGAGGGTGGAGG - Intronic
1058979530 9:110156349-110156371 GCTGGGGCCTTCAGTGGTGGGGG - Exonic
1059006208 9:110406124-110406146 TCTAGGGTCTCCAAGGGGTGCGG - Intronic
1060647267 9:125291664-125291686 GCTGGGGTTTTTAATGGTGGAGG + Intronic
1062026066 9:134341366-134341388 CCTGGGGGCTGCTAGGGTGGGGG + Intronic
1062206425 9:135339929-135339951 TCTGGGGTCTTCCCGGGTGAGGG + Intergenic
1062311585 9:135940846-135940868 TCTGGGGGCTTCAAGAGAGTGGG - Intronic
1187200245 X:17127679-17127701 TTTGGGGACTTGCAGGGTGGAGG - Intronic
1189346516 X:40245817-40245839 GCTGGCCTCTTCAAGGGAGGTGG - Intergenic
1192501833 X:71659715-71659737 TCTGGGGTGTGCAAAGGGGGAGG + Intergenic
1193052624 X:77117062-77117084 GCTGGGTTATTCAAAGGTGGTGG - Intergenic
1194847156 X:98824557-98824579 TCTGGGCAGTTAAAGGGTGGAGG + Intergenic
1195570966 X:106398055-106398077 CCTGGGGTCTATAAGGGTAGTGG + Intergenic
1195744243 X:108098638-108098660 TCAGGGGTTATCAATGGTGGGGG - Intronic
1195876610 X:109549195-109549217 TTTGGGGTGTTCAAGGAGGGAGG - Intergenic
1197929505 X:131679939-131679961 TCTGGGGTCTCAAAGGGGGGCGG - Intergenic
1199366592 X:146992868-146992890 TATTTGGTTTTCAAGGGTGGAGG - Intergenic
1200082123 X:153582663-153582685 TTTGCAGTCTTCAAGGCTGGGGG + Exonic