ID: 1076368222

View in Genome Browser
Species Human (GRCh38)
Location 10:129935805-129935827
Sequence CAGCCCACATTCTATGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076368222_1076368227 -10 Left 1076368222 10:129935805-129935827 CCAAGGGCATAGAATGTGGGCTG 0: 1
1: 0
2: 2
3: 13
4: 175
Right 1076368227 10:129935818-129935840 ATGTGGGCTGGGGACAGGAGAGG No data
1076368222_1076368232 29 Left 1076368222 10:129935805-129935827 CCAAGGGCATAGAATGTGGGCTG 0: 1
1: 0
2: 2
3: 13
4: 175
Right 1076368232 10:129935857-129935879 GGCCACGATCAGCCACAGGCAGG No data
1076368222_1076368228 8 Left 1076368222 10:129935805-129935827 CCAAGGGCATAGAATGTGGGCTG 0: 1
1: 0
2: 2
3: 13
4: 175
Right 1076368228 10:129935836-129935858 AGAGGCCAAGACACCAAGAGCGG No data
1076368222_1076368231 25 Left 1076368222 10:129935805-129935827 CCAAGGGCATAGAATGTGGGCTG 0: 1
1: 0
2: 2
3: 13
4: 175
Right 1076368231 10:129935853-129935875 GAGCGGCCACGATCAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076368222 Original CRISPR CAGCCCACATTCTATGCCCT TGG (reversed) Intronic
902704894 1:18197809-18197831 CAGGCATCATTCTAAGCCCTTGG - Intronic
902886499 1:19408481-19408503 CAGCCCACAGTCTTTGTCCCTGG - Intronic
902932776 1:19743122-19743144 CAGCCCATATTCTTGGCCATAGG - Intronic
903336303 1:22626896-22626918 CAGCCCACAAGCCCTGCCCTAGG - Intergenic
904661837 1:32091354-32091376 CAGCCCACATTCGCTGGGCTCGG - Intronic
907329998 1:53664574-53664596 CAGGCACCATTCTAGGCCCTGGG + Intronic
907892644 1:58650166-58650188 CAGCCCAGCTTCTCTGCCCAGGG - Intergenic
908554879 1:65248020-65248042 CAGACCACATTCTTTTCCCATGG + Intergenic
909126097 1:71671923-71671945 CAGCTCTCATTCTATTGCCTAGG + Intronic
910578845 1:88798864-88798886 CAGCCCACATTTTTTCCCCAAGG - Intronic
912856982 1:113178109-113178131 CAGCCCACAGCCTCTGCCCAAGG + Intergenic
913385342 1:118252906-118252928 GAGCCCAATTCCTATGCCCTGGG - Intergenic
915225885 1:154410991-154411013 CAGCCCACCATCTATGCAATGGG - Intronic
916477757 1:165186217-165186239 CAGCCCACCCTCTAGCCCCTGGG - Intergenic
917590835 1:176475383-176475405 AAGCCCAGATTCTCTGCTCTTGG + Intronic
921929442 1:220743071-220743093 AAGCCCCCATTCCAGGCCCTAGG - Intergenic
1064335854 10:14440630-14440652 CAGACCACAGTGTCTGCCCTGGG - Intronic
1066333093 10:34446376-34446398 CAGCCCTGATTCTAAGCCTTTGG + Intronic
1071256863 10:83879003-83879025 CACCCCACATCCAATGCCCGGGG - Intergenic
1072579621 10:96729385-96729407 CAGGCCCCATTCCATGTCCTGGG - Intergenic
1072660291 10:97359810-97359832 CAGCTCACCTACTGTGCCCTGGG - Intronic
1074262164 10:111864948-111864970 AAGCCAACATTCTATTCCTTGGG + Intergenic
1076368222 10:129935805-129935827 CAGCCCACATTCTATGCCCTTGG - Intronic
1076625872 10:131821635-131821657 CAACCCACATCATACGCCCTGGG + Intergenic
1076752327 10:132549759-132549781 CAGCCCCCACTCTCTGCCCCTGG + Intronic
1081674011 11:44957724-44957746 AAGCCCACATTTTTTTCCCTTGG + Intergenic
1088535322 11:110854056-110854078 AAGCCCACATTCTTAACCCTAGG + Intergenic
1088792092 11:113235194-113235216 CAGCCCACCTTCTTCTCCCTGGG + Intronic
1089334559 11:117714160-117714182 CAGCACACTTACTATGCCCCAGG - Intronic
1090045607 11:123329940-123329962 CATTCCATAATCTATGCCCTTGG - Intergenic
1092073533 12:5653686-5653708 CAGCTCAAATTCTTGGCCCTAGG + Intronic
1092175235 12:6400052-6400074 CAGCTCATATTTTATGGCCTTGG + Intergenic
1097023746 12:56038687-56038709 CAAAACACATTCTATGCCCAGGG + Intergenic
1097282062 12:57851133-57851155 CAGCCCCGATACTCTGCCCTGGG - Intergenic
1097473287 12:60021915-60021937 AAGCCCCCATTCCAAGCCCTAGG - Intergenic
1097624704 12:61985975-61985997 CAGCCCACAACCATTGCCCTTGG + Intronic
1098188942 12:67927196-67927218 GAACCCAAATTCTGTGCCCTTGG - Intergenic
1103274475 12:119700205-119700227 CAGCCCACAGTCCCAGCCCTGGG - Intronic
1103437181 12:120936065-120936087 TAGGCCACATTCTGTTCCCTCGG + Intergenic
1104275488 12:127323235-127323257 CAGGCCAGGTTCTATGCTCTGGG + Intergenic
1106420267 13:29580116-29580138 CAGGCCACATTTTTTGCCTTGGG - Intronic
1108341212 13:49499944-49499966 TACCCCAGATTCTGTGCCCTGGG + Intronic
1113889247 13:113727317-113727339 CAGCCCACGGTCTATGGACTGGG + Intronic
1115180441 14:30620240-30620262 TTGCCCACATTCTGTGCACTTGG + Intergenic
1118175977 14:63440443-63440465 CAGACCACATAGTATGCTCTGGG - Intronic
1119892578 14:78194015-78194037 CAGCCCCCTTTCTATGCCTATGG - Intergenic
1120096940 14:80399925-80399947 GACCACACATTCTTTGCCCTTGG + Intergenic
1120701844 14:87706671-87706693 CCTACCAAATTCTATGCCCTGGG - Intergenic
1127575630 15:60288931-60288953 CAGCCCACACTGGATGCACTTGG + Intergenic
1127698334 15:61473271-61473293 CAGCCCAGATTCTAAGGCCTGGG - Intergenic
1128725956 15:69988778-69988800 CAGCCCTCCTGCTGTGCCCTGGG - Intergenic
1129169276 15:73798009-73798031 CAGGCCCCATTCTGGGCCCTGGG + Intergenic
1130937824 15:88485208-88485230 CAAGCCAGATTCTATGCCCCAGG + Intergenic
1130996131 15:88905362-88905384 CAGACACCATTCTAGGCCCTGGG + Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1134050917 16:11136792-11136814 CAGCACACATCCTGTCCCCTGGG + Intronic
1134621887 16:15695525-15695547 AAGGCCAAATTCTTTGCCCTAGG - Intronic
1135989963 16:27212345-27212367 CAACCCACACCCCATGCCCTTGG - Intronic
1137555519 16:49468032-49468054 CAGCCCAGATGCTAGGCTCTAGG - Intergenic
1138475996 16:57270937-57270959 CAGGCGCTATTCTATGCCCTGGG + Intronic
1140194641 16:72846339-72846361 CAGCCCTCCTTCTGTGCCCTGGG - Intronic
1141017572 16:80464923-80464945 CACCCCACATTCTCTGTCCTTGG - Intergenic
1144548454 17:16218367-16218389 TAGGCCTTATTCTATGCCCTAGG + Intronic
1145272925 17:21414155-21414177 CAGGCCGCATTCTAGGCCCTGGG + Intronic
1145311128 17:21701591-21701613 CAGGCCGCATTCTAGGCCCTGGG + Intronic
1145977355 17:28992028-28992050 CAGGCCAGATACTCTGCCCTCGG - Intronic
1149380099 17:56084948-56084970 GAGCCCAGATTGTCTGCCCTGGG - Intergenic
1150699367 17:67434142-67434164 CAGCCCAGGTTCTAGGCACTGGG - Intronic
1151360707 17:73587152-73587174 CAACTCAAATTCCATGCCCTTGG + Intronic
1151403528 17:73871890-73871912 GAGACCAGTTTCTATGCCCTTGG + Intergenic
1151930317 17:77228024-77228046 CTGCCCACATTCTCTGCCCTGGG + Intergenic
1152350480 17:79781520-79781542 CAGACCCCATTCTTTGCACTAGG - Intronic
1152471190 17:80490915-80490937 CTGCCAACATTCTGTGCTCTTGG - Intergenic
1152780529 17:82225769-82225791 CAGCCCACATCCTGCGTCCTTGG - Intergenic
1155363917 18:25031744-25031766 CTCCCAACATTCTGTGCCCTTGG + Intergenic
1155554317 18:27001340-27001362 CTGCTCACATTCCATGCCCAAGG + Intronic
1158557237 18:58485506-58485528 GAGCCCACAGTCCATGGCCTTGG + Intronic
1161041116 19:2111228-2111250 CAGCCCACACTCTTTGGCATGGG - Intronic
1162342099 19:10097426-10097448 CAGCCCCCTTTCTAGGCACTGGG + Intronic
1164780376 19:30886689-30886711 CATCCCACCTTCTATGACCCTGG - Intergenic
1167978506 19:53253137-53253159 CAGCCCACACAATATGACCTCGG - Exonic
925360679 2:3278305-3278327 CTGCCCACATGCCCTGCCCTTGG + Intronic
926086203 2:10021985-10022007 AAGCCCACGTCCTATTCCCTGGG + Intergenic
927853796 2:26515757-26515779 TAGCCCAGATTCTGTCCCCTTGG + Intronic
927884116 2:26707984-26708006 CAGGCCCCATTCTAGGCCCCAGG + Intronic
929468407 2:42167825-42167847 CAGGCCACACTCTCTGCCTTAGG - Intergenic
929533612 2:42767257-42767279 CAGCCCAGATGCCATGCCCCTGG - Exonic
930103063 2:47617926-47617948 CAGGCCACACTCTTTGGCCTTGG + Intergenic
931810865 2:65853793-65853815 CAGCCCAGATTCTCTTCTCTTGG + Intergenic
932376008 2:71236346-71236368 CAGCCCGCACTCTATGCCTGCGG - Intergenic
932430417 2:71670766-71670788 CAGCACCCATTCTGTGCTCTGGG - Intronic
933318573 2:80744181-80744203 CAGCCCATATTCTGGGGCCTTGG - Intergenic
934163598 2:89274420-89274442 CAGGGAACATTCTATGCCATGGG + Intergenic
934203675 2:89908104-89908126 CAGGGAACATTCTATGCCATGGG - Intergenic
935148665 2:100414150-100414172 CAGACCACAGTCTTTGCCCAGGG - Intronic
936080757 2:109430940-109430962 CTGCCCTCATTCAATGACCTTGG - Intronic
937260590 2:120584559-120584581 CAGCCCACAGTCCATGAGCTGGG - Intergenic
939846256 2:147249730-147249752 CATCCCACATACTATGCCACTGG - Intergenic
942490824 2:176488214-176488236 CAGCCCCCATTTAATGGCCTGGG - Intergenic
942721368 2:178956850-178956872 CAGCCCAGATTCTTTCCCCCAGG - Intronic
943676936 2:190724837-190724859 CAGCCGAGACTCTATGCCCAGGG - Intergenic
945936023 2:215903515-215903537 CAGCCCTTGTTCTAAGCCCTTGG - Intergenic
946076343 2:217076860-217076882 GAGCCCACATTTTATGCTGTTGG + Intergenic
947135601 2:226974151-226974173 CTTCCCACATTCTATGCACAGGG - Intronic
948423968 2:237876448-237876470 CAGGCCACATCCTCTGCCCAGGG - Intronic
948461982 2:238134235-238134257 CTGCCCACTCGCTATGCCCTTGG + Intergenic
1169884454 20:10383035-10383057 CAGCCCAAATACTATTTCCTGGG + Intergenic
1170801533 20:19594289-19594311 CAGACCAGATTTCATGCCCTAGG + Intronic
1170807642 20:19647038-19647060 AAGCCCACATTTTCTGCCCTTGG + Intronic
1172007776 20:31829303-31829325 CAGCCCACAGGCCATGTCCTGGG + Intronic
1172188844 20:33049465-33049487 CAGCCCACATTTTCTGCTCAGGG - Intergenic
1173904628 20:46617244-46617266 CTGACCACATTTTATGCCCTGGG + Intronic
1175706243 20:61179309-61179331 CTGCCCACATTCTGTGGCTTTGG - Intergenic
1175777817 20:61664037-61664059 CAGCCCCCACACAATGCCCTTGG - Intronic
1176897415 21:14397699-14397721 CTGCCTACATTCTAGTCCCTTGG - Intergenic
1177902153 21:26930035-26930057 CAGCCTACATTCAGTGCCATCGG + Exonic
1180985741 22:19903124-19903146 CAGCCCACACACTGGGCCCTGGG - Intronic
1181543107 22:23584393-23584415 CTGCCCACTCTCTATGCCCCAGG + Intergenic
952324911 3:32312487-32312509 CTGCCCACATGCCTTGCCCTGGG - Intronic
953310421 3:41872493-41872515 CTGCCTAAACTCTATGCCCTTGG + Intronic
954108368 3:48421070-48421092 AAGCCTCCATTCTGTGCCCTTGG - Intronic
954295231 3:49670785-49670807 CAGACCACATGCTCTGCCCAAGG - Exonic
961618543 3:128204730-128204752 CAGCACACTTACCATGCCCTGGG - Intronic
964792289 3:160463599-160463621 CAGCTCACATTCTCTGGGCTGGG - Intronic
969864619 4:10066413-10066435 CAAACCACAGTCTTTGCCCTGGG - Intergenic
970657778 4:18250709-18250731 CAGACCACATTCTAGGCCTGGGG - Intergenic
973337132 4:48968002-48968024 CATTTCACATTCTTTGCCCTTGG + Intergenic
975974794 4:80082302-80082324 CAGCCCAGATACTATGACATTGG + Intronic
977727933 4:100319485-100319507 CAGACACCATTCTAGGCCCTGGG + Intergenic
978167150 4:105622972-105622994 CAGTCCAAATTCTATGCCTTTGG + Intronic
979961834 4:127029796-127029818 TTGCCCACATTCTTTGCCTTGGG - Intergenic
982690346 4:158541058-158541080 CAGCCAACAGTCACTGCCCTGGG + Intronic
984832294 4:183986955-183986977 CACCCCACATTTTGTGCCCCTGG + Intronic
986674086 5:10168431-10168453 CAGCCCACAGCCTATGGCTTTGG + Intergenic
991600490 5:68347461-68347483 CAGGCCATATTTTATGCCCTGGG + Intergenic
992491449 5:77248247-77248269 CAGCCAGCATTCTTGGCCCTTGG - Intronic
996186306 5:120480076-120480098 CAGGCTGCATTGTATGCCCTTGG + Intronic
997362110 5:133301717-133301739 CAGCCTGCAAGCTATGCCCTTGG - Intronic
998151302 5:139759017-139759039 CAGCTCACATTCCATGCTCCAGG + Intergenic
1002676157 5:180914926-180914948 CAGCCCACAATTTTTGCCATGGG + Intronic
1003840620 6:10115441-10115463 CAGCCCACAGTCTAGGTCCCAGG - Intronic
1006729519 6:36225801-36225823 CATCACACATTTTAAGCCCTGGG - Intronic
1007046442 6:38779840-38779862 CAGCCCTCATTCGTTGTCCTAGG - Intronic
1010708076 6:79138058-79138080 CAGCCAACATTTTATGGACTAGG + Intergenic
1013860974 6:114634849-114634871 CTGTCCACACTCTATGCCCATGG + Intergenic
1014285875 6:119496960-119496982 CAGACCTCATTCTATACACTGGG - Intergenic
1014368161 6:120571434-120571456 CAGCCAGCATTCTTTGCCCAGGG + Intergenic
1015380513 6:132562182-132562204 CAGTCCTAACTCTATGCCCTGGG - Intergenic
1015948136 6:138523795-138523817 AAGCCCAAATCCTATGCCATAGG + Intronic
1019392863 7:799155-799177 CAGGCCACATTCTGTGGCCCGGG - Intergenic
1019999905 7:4749725-4749747 CAGTCCACCCTCAATGCCCTTGG - Intronic
1024601145 7:50982699-50982721 CAGGCCACATCCTATGAGCTGGG - Intergenic
1026994308 7:74605917-74605939 CAGGCCTCATTCTGGGCCCTGGG - Intergenic
1028596680 7:92553519-92553541 GAGCTCAACTTCTATGCCCTAGG + Intergenic
1029393691 7:100292245-100292267 CAGCCAACATTGGATGACCTTGG + Intergenic
1031987118 7:128170404-128170426 CAGCCCAAATTCAGTCCCCTGGG + Intergenic
1033279755 7:139997286-139997308 TAGCCCACTTTCTCTGCACTGGG - Intronic
1034276640 7:149826723-149826745 CACCCAGCATTCTCTGCCCTGGG + Intergenic
1036618513 8:10406781-10406803 TGGCCCACTTTCTAGGCCCTAGG + Intronic
1036814021 8:11887891-11887913 CAGCCCCCATTCTACTTCCTGGG - Intergenic
1037267348 8:17079161-17079183 CAGCATAGATTCTATCCCCTGGG - Intronic
1038167307 8:25098419-25098441 CTGCCCACATTCTATTGTCTAGG + Intergenic
1041003016 8:53470209-53470231 CAGCTCACCTTTTCTGCCCTGGG + Intergenic
1045754524 8:105527070-105527092 CACCCTACTTTCTATGTCCTAGG - Intronic
1048552956 8:135450674-135450696 CTGCACCCATTCTATGCCCCTGG + Intergenic
1049379937 8:142307050-142307072 AATCCCACAGTCTATCCCCTTGG + Intronic
1049750304 8:144279936-144279958 CAGCTCACATCCTGTGCTCTGGG - Intronic
1052769059 9:32670806-32670828 CATCCCATCTTCTATGCCTTTGG - Intergenic
1055398367 9:75897264-75897286 CAGCCCCCATTATATCCCCAGGG - Intronic
1056280138 9:85033898-85033920 CATTCCACATTCTAATCCCTGGG + Intergenic
1056901845 9:90607174-90607196 CTGCCCACATGCTCTACCCTGGG - Intergenic
1057046684 9:91891717-91891739 CTGCCCACATTCCCGGCCCTGGG + Intronic
1057190564 9:93084721-93084743 CAGCCCGCAGCATATGCCCTAGG + Exonic
1058957591 9:109963587-109963609 CAGCCCCCATACTGGGCCCTGGG + Intronic
1059002042 9:110358514-110358536 CAGTCCACATTCTATGTCCATGG + Intergenic
1061292173 9:129656901-129656923 CAGACCCCAGTCTATCCCCTGGG - Intergenic
1061397248 9:130349781-130349803 CAGCCCTCAGTCTGGGCCCTGGG - Intronic
1061499651 9:130994494-130994516 CAGCCCACACTCTGGGCCCTGGG - Intergenic
1062145146 9:134984922-134984944 CAGCCCACAGTCTCAGCCATCGG - Intergenic
1062218588 9:135402474-135402496 CAGTCCACATGCTAGGCTCTGGG - Intergenic
1187135963 X:16547735-16547757 CAACCAACAGTCTATGCCTTAGG - Intergenic
1191090528 X:56616158-56616180 CACACCACAATCTATGCCCAGGG - Intergenic
1195122992 X:101775370-101775392 AAGCCCCCATTCCAAGCCCTAGG - Intergenic
1195137685 X:101926190-101926212 TAGCTCACATTCTATGGACTTGG + Intronic
1197642024 X:128977493-128977515 CAAGCCACATTCTATGCCCTGGG - Intergenic
1197695226 X:129542178-129542200 CAGCCCAGAATCTAGTCCCTCGG + Intronic
1197803442 X:130376114-130376136 CAACCCACATCCTTTCCCCTAGG + Intergenic
1198058204 X:133016412-133016434 CATTCCACATTTTATGCCATTGG + Intergenic
1199971223 X:152863387-152863409 CAGCCCACCCTCAATGCCATGGG + Intronic
1200926947 Y:8663219-8663241 CTGCTCACACTCTATGCCCTAGG - Intergenic
1200936256 Y:8740949-8740971 CTGCTTACACTCTATGCCCTAGG + Intergenic