ID: 1076368903

View in Genome Browser
Species Human (GRCh38)
Location 10:129939259-129939281
Sequence CTGGGAGAGGGGAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3383
Summary {0: 1, 1: 0, 2: 27, 3: 320, 4: 3035}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076368903_1076368919 28 Left 1076368903 10:129939259-129939281 CCCTCCACCCTCCCCTCTCCCAG 0: 1
1: 0
2: 27
3: 320
4: 3035
Right 1076368919 10:129939310-129939332 GACTGACAAATACGAAGGACAGG No data
1076368903_1076368914 5 Left 1076368903 10:129939259-129939281 CCCTCCACCCTCCCCTCTCCCAG 0: 1
1: 0
2: 27
3: 320
4: 3035
Right 1076368914 10:129939287-129939309 AAGTATCCTGCCACTTCTCAAGG No data
1076368903_1076368918 23 Left 1076368903 10:129939259-129939281 CCCTCCACCCTCCCCTCTCCCAG 0: 1
1: 0
2: 27
3: 320
4: 3035
Right 1076368918 10:129939305-129939327 CAAGGGACTGACAAATACGAAGG No data
1076368903_1076368920 29 Left 1076368903 10:129939259-129939281 CCCTCCACCCTCCCCTCTCCCAG 0: 1
1: 0
2: 27
3: 320
4: 3035
Right 1076368920 10:129939311-129939333 ACTGACAAATACGAAGGACAGGG No data
1076368903_1076368915 6 Left 1076368903 10:129939259-129939281 CCCTCCACCCTCCCCTCTCCCAG 0: 1
1: 0
2: 27
3: 320
4: 3035
Right 1076368915 10:129939288-129939310 AGTATCCTGCCACTTCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076368903 Original CRISPR CTGGGAGAGGGGAGGGTGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr