ID: 1076368915

View in Genome Browser
Species Human (GRCh38)
Location 10:129939288-129939310
Sequence AGTATCCTGCCACTTCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076368902_1076368915 10 Left 1076368902 10:129939255-129939277 CCTGCCCTCCACCCTCCCCTCTC 0: 1
1: 2
2: 42
3: 547
4: 3634
Right 1076368915 10:129939288-129939310 AGTATCCTGCCACTTCTCAAGGG No data
1076368904_1076368915 5 Left 1076368904 10:129939260-129939282 CCTCCACCCTCCCCTCTCCCAGG 0: 1
1: 1
2: 15
3: 227
4: 1849
Right 1076368915 10:129939288-129939310 AGTATCCTGCCACTTCTCAAGGG No data
1076368900_1076368915 17 Left 1076368900 10:129939248-129939270 CCTCCTTCCTGCCCTCCACCCTC 0: 1
1: 3
2: 76
3: 690
4: 4549
Right 1076368915 10:129939288-129939310 AGTATCCTGCCACTTCTCAAGGG No data
1076368897_1076368915 24 Left 1076368897 10:129939241-129939263 CCCTGGCCCTCCTTCCTGCCCTC 0: 1
1: 1
2: 16
3: 150
4: 1357
Right 1076368915 10:129939288-129939310 AGTATCCTGCCACTTCTCAAGGG No data
1076368910_1076368915 -6 Left 1076368910 10:129939271-129939293 CCCTCTCCCAGGTCAAAAGTATC 0: 1
1: 0
2: 0
3: 18
4: 204
Right 1076368915 10:129939288-129939310 AGTATCCTGCCACTTCTCAAGGG No data
1076368911_1076368915 -7 Left 1076368911 10:129939272-129939294 CCTCTCCCAGGTCAAAAGTATCC 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1076368915 10:129939288-129939310 AGTATCCTGCCACTTCTCAAGGG No data
1076368898_1076368915 23 Left 1076368898 10:129939242-129939264 CCTGGCCCTCCTTCCTGCCCTCC 0: 1
1: 2
2: 18
3: 253
4: 2643
Right 1076368915 10:129939288-129939310 AGTATCCTGCCACTTCTCAAGGG No data
1076368907_1076368915 -1 Left 1076368907 10:129939266-129939288 CCCTCCCCTCTCCCAGGTCAAAA 0: 1
1: 0
2: 2
3: 35
4: 362
Right 1076368915 10:129939288-129939310 AGTATCCTGCCACTTCTCAAGGG No data
1076368909_1076368915 -5 Left 1076368909 10:129939270-129939292 CCCCTCTCCCAGGTCAAAAGTAT 0: 1
1: 0
2: 0
3: 15
4: 199
Right 1076368915 10:129939288-129939310 AGTATCCTGCCACTTCTCAAGGG No data
1076368908_1076368915 -2 Left 1076368908 10:129939267-129939289 CCTCCCCTCTCCCAGGTCAAAAG 0: 1
1: 0
2: 0
3: 19
4: 265
Right 1076368915 10:129939288-129939310 AGTATCCTGCCACTTCTCAAGGG No data
1076368899_1076368915 18 Left 1076368899 10:129939247-129939269 CCCTCCTTCCTGCCCTCCACCCT 0: 1
1: 3
2: 108
3: 3520
4: 49999
Right 1076368915 10:129939288-129939310 AGTATCCTGCCACTTCTCAAGGG No data
1076368906_1076368915 2 Left 1076368906 10:129939263-129939285 CCACCCTCCCCTCTCCCAGGTCA 0: 1
1: 1
2: 9
3: 137
4: 1095
Right 1076368915 10:129939288-129939310 AGTATCCTGCCACTTCTCAAGGG No data
1076368901_1076368915 14 Left 1076368901 10:129939251-129939273 CCTTCCTGCCCTCCACCCTCCCC 0: 1
1: 6
2: 38
3: 633
4: 6200
Right 1076368915 10:129939288-129939310 AGTATCCTGCCACTTCTCAAGGG No data
1076368903_1076368915 6 Left 1076368903 10:129939259-129939281 CCCTCCACCCTCCCCTCTCCCAG 0: 1
1: 0
2: 27
3: 320
4: 3035
Right 1076368915 10:129939288-129939310 AGTATCCTGCCACTTCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076368915 Original CRISPR AGTATCCTGCCACTTCTCAA GGG Intronic
No off target data available for this crispr