ID: 1076368920

View in Genome Browser
Species Human (GRCh38)
Location 10:129939311-129939333
Sequence ACTGACAAATACGAAGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076368910_1076368920 17 Left 1076368910 10:129939271-129939293 CCCTCTCCCAGGTCAAAAGTATC 0: 1
1: 0
2: 0
3: 18
4: 204
Right 1076368920 10:129939311-129939333 ACTGACAAATACGAAGGACAGGG No data
1076368908_1076368920 21 Left 1076368908 10:129939267-129939289 CCTCCCCTCTCCCAGGTCAAAAG 0: 1
1: 0
2: 0
3: 19
4: 265
Right 1076368920 10:129939311-129939333 ACTGACAAATACGAAGGACAGGG No data
1076368909_1076368920 18 Left 1076368909 10:129939270-129939292 CCCCTCTCCCAGGTCAAAAGTAT 0: 1
1: 0
2: 0
3: 15
4: 199
Right 1076368920 10:129939311-129939333 ACTGACAAATACGAAGGACAGGG No data
1076368904_1076368920 28 Left 1076368904 10:129939260-129939282 CCTCCACCCTCCCCTCTCCCAGG 0: 1
1: 1
2: 15
3: 227
4: 1849
Right 1076368920 10:129939311-129939333 ACTGACAAATACGAAGGACAGGG No data
1076368917_1076368920 -9 Left 1076368917 10:129939297-129939319 CCACTTCTCAAGGGACTGACAAA 0: 1
1: 0
2: 0
3: 10
4: 185
Right 1076368920 10:129939311-129939333 ACTGACAAATACGAAGGACAGGG No data
1076368911_1076368920 16 Left 1076368911 10:129939272-129939294 CCTCTCCCAGGTCAAAAGTATCC 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1076368920 10:129939311-129939333 ACTGACAAATACGAAGGACAGGG No data
1076368907_1076368920 22 Left 1076368907 10:129939266-129939288 CCCTCCCCTCTCCCAGGTCAAAA 0: 1
1: 0
2: 2
3: 35
4: 362
Right 1076368920 10:129939311-129939333 ACTGACAAATACGAAGGACAGGG No data
1076368912_1076368920 11 Left 1076368912 10:129939277-129939299 CCCAGGTCAAAAGTATCCTGCCA 0: 1
1: 0
2: 0
3: 8
4: 174
Right 1076368920 10:129939311-129939333 ACTGACAAATACGAAGGACAGGG No data
1076368903_1076368920 29 Left 1076368903 10:129939259-129939281 CCCTCCACCCTCCCCTCTCCCAG 0: 1
1: 0
2: 27
3: 320
4: 3035
Right 1076368920 10:129939311-129939333 ACTGACAAATACGAAGGACAGGG No data
1076368916_1076368920 -5 Left 1076368916 10:129939293-129939315 CCTGCCACTTCTCAAGGGACTGA 0: 1
1: 0
2: 0
3: 20
4: 196
Right 1076368920 10:129939311-129939333 ACTGACAAATACGAAGGACAGGG No data
1076368913_1076368920 10 Left 1076368913 10:129939278-129939300 CCAGGTCAAAAGTATCCTGCCAC 0: 1
1: 0
2: 0
3: 6
4: 137
Right 1076368920 10:129939311-129939333 ACTGACAAATACGAAGGACAGGG No data
1076368906_1076368920 25 Left 1076368906 10:129939263-129939285 CCACCCTCCCCTCTCCCAGGTCA 0: 1
1: 1
2: 9
3: 137
4: 1095
Right 1076368920 10:129939311-129939333 ACTGACAAATACGAAGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076368920 Original CRISPR ACTGACAAATACGAAGGACA GGG Intronic
No off target data available for this crispr