ID: 1076369780

View in Genome Browser
Species Human (GRCh38)
Location 10:129944979-129945001
Sequence CTTGGTAAACTGATTTTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076369779_1076369780 -10 Left 1076369779 10:129944966-129944988 CCATGATGCATTTCTTGGTAAAC No data
Right 1076369780 10:129944979-129945001 CTTGGTAAACTGATTTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076369780 Original CRISPR CTTGGTAAACTGATTTTGCA AGG Intronic
No off target data available for this crispr