ID: 1076372053

View in Genome Browser
Species Human (GRCh38)
Location 10:129961793-129961815
Sequence GAGTTAGCTGCCTTTGTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076372052_1076372053 -5 Left 1076372052 10:129961775-129961797 CCAACTCGATGGGCTTAGGAGTT No data
Right 1076372053 10:129961793-129961815 GAGTTAGCTGCCTTTGTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076372053 Original CRISPR GAGTTAGCTGCCTTTGTTAT AGG Intronic
No off target data available for this crispr