ID: 1076372405

View in Genome Browser
Species Human (GRCh38)
Location 10:129963982-129964004
Sequence CTTCGAAGCGCCGCCGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 48}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076372405_1076372408 -10 Left 1076372405 10:129963982-129964004 CCGGCGGCGGCGGCGCTTCGAAG 0: 1
1: 0
2: 1
3: 9
4: 48
Right 1076372408 10:129963995-129964017 CGCTTCGAAGGAGCAGGACGCGG 0: 1
1: 0
2: 0
3: 2
4: 57
1076372405_1076372410 -1 Left 1076372405 10:129963982-129964004 CCGGCGGCGGCGGCGCTTCGAAG 0: 1
1: 0
2: 1
3: 9
4: 48
Right 1076372410 10:129964004-129964026 GGAGCAGGACGCGGTGGCCGCGG 0: 1
1: 1
2: 2
3: 64
4: 521
1076372405_1076372411 2 Left 1076372405 10:129963982-129964004 CCGGCGGCGGCGGCGCTTCGAAG 0: 1
1: 0
2: 1
3: 9
4: 48
Right 1076372411 10:129964007-129964029 GCAGGACGCGGTGGCCGCGGCGG 0: 1
1: 0
2: 7
3: 63
4: 425
1076372405_1076372409 -7 Left 1076372405 10:129963982-129964004 CCGGCGGCGGCGGCGCTTCGAAG 0: 1
1: 0
2: 1
3: 9
4: 48
Right 1076372409 10:129963998-129964020 TTCGAAGGAGCAGGACGCGGTGG 0: 1
1: 0
2: 0
3: 8
4: 107
1076372405_1076372413 28 Left 1076372405 10:129963982-129964004 CCGGCGGCGGCGGCGCTTCGAAG 0: 1
1: 0
2: 1
3: 9
4: 48
Right 1076372413 10:129964033-129964055 TTGTTGTTGTTGTTGTTTGCAGG 0: 5
1: 56
2: 359
3: 968
4: 2868

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076372405 Original CRISPR CTTCGAAGCGCCGCCGCCGC CGG (reversed) Intergenic
900578036 1:3393998-3394020 CCTGGAGCCGCCGCCGCCGCGGG - Intronic
901109783 1:6785472-6785494 CCTCGTACCGCCGCCGCCGCCGG - Exonic
902453380 1:16513758-16513780 CTTCCAAGCGCAGCCCCCACAGG - Intergenic
902473431 1:16666434-16666456 CTTCCAAGCGCAGCCCCCACAGG - Intergenic
902485372 1:16741008-16741030 CTTCCAAGCGCAGCCCCCACAGG + Intronic
902499103 1:16896485-16896507 CTTCCAAGCGCAGCCCCCACAGG + Intronic
903907112 1:26695549-26695571 CTAGGCAGCGCCGCCGCCGAAGG - Intergenic
906520935 1:46466554-46466576 CTTCAAAGCGCCGGCGGCGCGGG - Intergenic
908534633 1:65066695-65066717 CTCCGGACCGCCGCCGCCGCGGG + Intergenic
913191717 1:116418652-116418674 CCGCGAAGCGCCGCCTCCGCGGG - Intergenic
914001578 1:143699097-143699119 CTTCTAAGCGCAGCCCCCTCAGG - Intergenic
914198654 1:145465286-145465308 CTTCTAACCGCAGCCTCCGCAGG - Intergenic
914477761 1:148038421-148038443 CTTCTAACCGCAGCCTCCGCAGG - Intergenic
920260540 1:204685272-204685294 CTGGGCAGCGCCGCCGCCGCCGG - Intronic
921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG + Intronic
921604757 1:217139698-217139720 CCGCGCACCGCCGCCGCCGCCGG - Intergenic
1062898098 10:1120356-1120378 CTATGAAGCGCCGCCTCCGAGGG + Intronic
1065188875 10:23192983-23193005 CCTCGGAGCGCACCCGCCGCCGG - Exonic
1074121689 10:110498105-110498127 CTTCATGCCGCCGCCGCCGCCGG - Exonic
1076372405 10:129963982-129964004 CTTCGAAGCGCCGCCGCCGCCGG - Intergenic
1076554254 10:131311692-131311714 CTCCGGAGCCGCGCCGCCGCCGG - Exonic
1082076608 11:47980451-47980473 CTGCGGAGCTCCGCAGCCGCCGG + Intergenic
1084296024 11:68213759-68213781 CGTGGAAGCGCCGCGGCGGCTGG - Intronic
1096784391 12:54008922-54008944 CGTGTAAGCGCCGCCACCGCCGG + Intronic
1106304097 13:28495049-28495071 CTCCGAGCCGCCGCCGCTGCCGG + Exonic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1130348017 15:83066898-83066920 GGTCGCGGCGCCGCCGCCGCTGG - Exonic
1143163839 17:4887736-4887758 CCTCTATGCGCCGCTGCCGCTGG - Exonic
1143198660 17:5097226-5097248 CTCCGCAGCGCTGACGCCGCTGG - Intergenic
1148556598 17:48582232-48582254 CTCCTCCGCGCCGCCGCCGCCGG - Intronic
1154173770 18:12068423-12068445 CTCCGCGCCGCCGCCGCCGCCGG + Intergenic
1161412418 19:4123890-4123912 GCTAGAGGCGCCGCCGCCGCCGG - Exonic
1162760594 19:12886127-12886149 CTTCGGAGCGCCACCACTGCGGG + Exonic
1166520265 19:43475359-43475381 CTTCGAGGCTCCGCCGGCGCGGG - Exonic
937208769 2:120253526-120253548 CTTAGAAGCCCCTTCGCCGCTGG - Intronic
944412585 2:199458298-199458320 CTTCGCAGCCCCGCCGCCGTTGG - Intronic
1172587265 20:36093469-36093491 GGTCCAGGCGCCGCCGCCGCTGG + Intronic
1172654365 20:36527998-36528020 CCACCCAGCGCCGCCGCCGCTGG + Exonic
1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG + Exonic
1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG + Intronic
953947574 3:47163352-47163374 GTCCGAGGCGCCGCCGTCGCGGG + Intronic
961340351 3:126213189-126213211 CGGCGAAGGGCCGCGGCCGCCGG - Intergenic
978373439 4:108051595-108051617 CTTTGAAGCCCAGCCGCAGCCGG - Intronic
979565685 4:122152281-122152303 CCTCGAGGCGCCGGCGACGCTGG + Intergenic
986330634 5:6713964-6713986 CATCCACGCGCCGCCCCCGCGGG - Intergenic
992550152 5:77852022-77852044 CCTCCTCGCGCCGCCGCCGCGGG + Intronic
1004241315 6:13924967-13924989 CTCCCAGGCGCCGCCGCAGCCGG + Exonic
1006737554 6:36285299-36285321 CTGCGAGGCGGCGGCGCCGCCGG - Intronic
1013117769 6:107115419-107115441 CGCCCGAGCGCCGCCGCCGCCGG - Intergenic
1019112009 6:169724211-169724233 GTGAGAAGCGCCGCCGCCGCTGG - Intronic
1019343799 7:520169-520191 CGCAGAAGCGCCGCCGTCGCCGG + Intronic
1022943730 7:35262055-35262077 GTTAGAAGCCCCGCCGCTGCAGG + Intergenic
1033299939 7:140176677-140176699 CGACCAACCGCCGCCGCCGCCGG - Intronic
1036723732 8:11201071-11201093 CGCCGCAGCGCCGCCGCCGACGG - Exonic
1045098946 8:98825892-98825914 CTTCTCTGGGCCGCCGCCGCAGG - Intronic
1060555277 9:124504736-124504758 CTCGGCCGCGCCGCCGCCGCCGG + Intronic
1061725597 9:132580492-132580514 ATTGGAAGCGGCCCCGCCGCCGG - Intergenic
1062346304 9:136116907-136116929 CGACCTAGCGCCGCCGCCGCCGG - Exonic
1185461431 X:334423-334445 CTTCGAGGCGCCCTCACCGCTGG - Exonic