ID: 1076373679

View in Genome Browser
Species Human (GRCh38)
Location 10:129969853-129969875
Sequence CCCGCTCGGGCGCATCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076373679_1076373685 3 Left 1076373679 10:129969853-129969875 CCTGCTGGATGCGCCCGAGCGGG No data
Right 1076373685 10:129969879-129969901 GGGAGACGCCGATTCCGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076373679 Original CRISPR CCCGCTCGGGCGCATCCAGC AGG (reversed) Intergenic