ID: 1076378390 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:130008319-130008341 |
Sequence | GTGAGCAAAACTGGTGCTCA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1076378390_1076378393 | -7 | Left | 1076378390 | 10:130008319-130008341 | CCATGAGCACCAGTTTTGCTCAC | No data | ||
Right | 1076378393 | 10:130008335-130008357 | TGCTCACAACTGTATACCCAGGG | No data | ||||
1076378390_1076378392 | -8 | Left | 1076378390 | 10:130008319-130008341 | CCATGAGCACCAGTTTTGCTCAC | No data | ||
Right | 1076378392 | 10:130008334-130008356 | TTGCTCACAACTGTATACCCAGG | No data | ||||
1076378390_1076378398 | 28 | Left | 1076378390 | 10:130008319-130008341 | CCATGAGCACCAGTTTTGCTCAC | No data | ||
Right | 1076378398 | 10:130008370-130008392 | GACCCAAAATTAGTAAAGTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1076378390 | Original CRISPR | GTGAGCAAAACTGGTGCTCA TGG (reversed) | Intergenic | ||