ID: 1076378390

View in Genome Browser
Species Human (GRCh38)
Location 10:130008319-130008341
Sequence GTGAGCAAAACTGGTGCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076378390_1076378393 -7 Left 1076378390 10:130008319-130008341 CCATGAGCACCAGTTTTGCTCAC No data
Right 1076378393 10:130008335-130008357 TGCTCACAACTGTATACCCAGGG No data
1076378390_1076378392 -8 Left 1076378390 10:130008319-130008341 CCATGAGCACCAGTTTTGCTCAC No data
Right 1076378392 10:130008334-130008356 TTGCTCACAACTGTATACCCAGG No data
1076378390_1076378398 28 Left 1076378390 10:130008319-130008341 CCATGAGCACCAGTTTTGCTCAC No data
Right 1076378398 10:130008370-130008392 GACCCAAAATTAGTAAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076378390 Original CRISPR GTGAGCAAAACTGGTGCTCA TGG (reversed) Intergenic