ID: 1076379517

View in Genome Browser
Species Human (GRCh38)
Location 10:130015496-130015518
Sequence CCCTGCACTGAGTGTGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076379517_1076379522 8 Left 1076379517 10:130015496-130015518 CCCAGGTCACACTCAGTGCAGGG No data
Right 1076379522 10:130015527-130015549 CCAGACGCCTCCTGTCCACCCGG No data
1076379517_1076379531 29 Left 1076379517 10:130015496-130015518 CCCAGGTCACACTCAGTGCAGGG No data
Right 1076379531 10:130015548-130015570 GGGTCCTGGGCTGCTTCCTCAGG No data
1076379517_1076379525 15 Left 1076379517 10:130015496-130015518 CCCAGGTCACACTCAGTGCAGGG No data
Right 1076379525 10:130015534-130015556 CCTCCTGTCCACCCGGGTCCTGG No data
1076379517_1076379526 16 Left 1076379517 10:130015496-130015518 CCCAGGTCACACTCAGTGCAGGG No data
Right 1076379526 10:130015535-130015557 CTCCTGTCCACCCGGGTCCTGGG No data
1076379517_1076379523 9 Left 1076379517 10:130015496-130015518 CCCAGGTCACACTCAGTGCAGGG No data
Right 1076379523 10:130015528-130015550 CAGACGCCTCCTGTCCACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076379517 Original CRISPR CCCTGCACTGAGTGTGACCT GGG (reversed) Intergenic