ID: 1076379551

View in Genome Browser
Species Human (GRCh38)
Location 10:130015751-130015773
Sequence CTGGGATAGGGCCCTGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076379551_1076379573 20 Left 1076379551 10:130015751-130015773 CCAAGCTCAGGGCCCTATCCCAG No data
Right 1076379573 10:130015794-130015816 CAGGCTGGGGATTGGGGAGCAGG No data
1076379551_1076379570 12 Left 1076379551 10:130015751-130015773 CCAAGCTCAGGGCCCTATCCCAG No data
Right 1076379570 10:130015786-130015808 CAGGCGGGCAGGCTGGGGATTGG No data
1076379551_1076379579 28 Left 1076379551 10:130015751-130015773 CCAAGCTCAGGGCCCTATCCCAG No data
Right 1076379579 10:130015802-130015824 GGATTGGGGAGCAGGGGTGGGGG No data
1076379551_1076379568 7 Left 1076379551 10:130015751-130015773 CCAAGCTCAGGGCCCTATCCCAG No data
Right 1076379568 10:130015781-130015803 GGGGCCAGGCGGGCAGGCTGGGG No data
1076379551_1076379576 25 Left 1076379551 10:130015751-130015773 CCAAGCTCAGGGCCCTATCCCAG No data
Right 1076379576 10:130015799-130015821 TGGGGATTGGGGAGCAGGGGTGG No data
1076379551_1076379578 27 Left 1076379551 10:130015751-130015773 CCAAGCTCAGGGCCCTATCCCAG No data
Right 1076379578 10:130015801-130015823 GGGATTGGGGAGCAGGGGTGGGG No data
1076379551_1076379574 21 Left 1076379551 10:130015751-130015773 CCAAGCTCAGGGCCCTATCCCAG No data
Right 1076379574 10:130015795-130015817 AGGCTGGGGATTGGGGAGCAGGG No data
1076379551_1076379572 14 Left 1076379551 10:130015751-130015773 CCAAGCTCAGGGCCCTATCCCAG No data
Right 1076379572 10:130015788-130015810 GGCGGGCAGGCTGGGGATTGGGG No data
1076379551_1076379566 5 Left 1076379551 10:130015751-130015773 CCAAGCTCAGGGCCCTATCCCAG No data
Right 1076379566 10:130015779-130015801 CTGGGGCCAGGCGGGCAGGCTGG No data
1076379551_1076379577 26 Left 1076379551 10:130015751-130015773 CCAAGCTCAGGGCCCTATCCCAG No data
Right 1076379577 10:130015800-130015822 GGGGATTGGGGAGCAGGGGTGGG No data
1076379551_1076379563 -3 Left 1076379551 10:130015751-130015773 CCAAGCTCAGGGCCCTATCCCAG No data
Right 1076379563 10:130015771-130015793 CAGTGGGCCTGGGGCCAGGCGGG No data
1076379551_1076379567 6 Left 1076379551 10:130015751-130015773 CCAAGCTCAGGGCCCTATCCCAG No data
Right 1076379567 10:130015780-130015802 TGGGGCCAGGCGGGCAGGCTGGG No data
1076379551_1076379564 1 Left 1076379551 10:130015751-130015773 CCAAGCTCAGGGCCCTATCCCAG No data
Right 1076379564 10:130015775-130015797 GGGCCTGGGGCCAGGCGGGCAGG No data
1076379551_1076379571 13 Left 1076379551 10:130015751-130015773 CCAAGCTCAGGGCCCTATCCCAG No data
Right 1076379571 10:130015787-130015809 AGGCGGGCAGGCTGGGGATTGGG No data
1076379551_1076379559 -7 Left 1076379551 10:130015751-130015773 CCAAGCTCAGGGCCCTATCCCAG No data
Right 1076379559 10:130015767-130015789 ATCCCAGTGGGCCTGGGGCCAGG No data
1076379551_1076379575 22 Left 1076379551 10:130015751-130015773 CCAAGCTCAGGGCCCTATCCCAG No data
Right 1076379575 10:130015796-130015818 GGCTGGGGATTGGGGAGCAGGGG No data
1076379551_1076379562 -4 Left 1076379551 10:130015751-130015773 CCAAGCTCAGGGCCCTATCCCAG No data
Right 1076379562 10:130015770-130015792 CCAGTGGGCCTGGGGCCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076379551 Original CRISPR CTGGGATAGGGCCCTGAGCT TGG (reversed) Intergenic
No off target data available for this crispr