ID: 1076379561

View in Genome Browser
Species Human (GRCh38)
Location 10:130015770-130015792
Sequence CCGCCTGGCCCCAGGCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076379561_1076379574 2 Left 1076379561 10:130015770-130015792 CCAGTGGGCCTGGGGCCAGGCGG No data
Right 1076379574 10:130015795-130015817 AGGCTGGGGATTGGGGAGCAGGG No data
1076379561_1076379572 -5 Left 1076379561 10:130015770-130015792 CCAGTGGGCCTGGGGCCAGGCGG No data
Right 1076379572 10:130015788-130015810 GGCGGGCAGGCTGGGGATTGGGG No data
1076379561_1076379577 7 Left 1076379561 10:130015770-130015792 CCAGTGGGCCTGGGGCCAGGCGG No data
Right 1076379577 10:130015800-130015822 GGGGATTGGGGAGCAGGGGTGGG No data
1076379561_1076379580 13 Left 1076379561 10:130015770-130015792 CCAGTGGGCCTGGGGCCAGGCGG No data
Right 1076379580 10:130015806-130015828 TGGGGAGCAGGGGTGGGGGTTGG No data
1076379561_1076379571 -6 Left 1076379561 10:130015770-130015792 CCAGTGGGCCTGGGGCCAGGCGG No data
Right 1076379571 10:130015787-130015809 AGGCGGGCAGGCTGGGGATTGGG No data
1076379561_1076379573 1 Left 1076379561 10:130015770-130015792 CCAGTGGGCCTGGGGCCAGGCGG No data
Right 1076379573 10:130015794-130015816 CAGGCTGGGGATTGGGGAGCAGG No data
1076379561_1076379576 6 Left 1076379561 10:130015770-130015792 CCAGTGGGCCTGGGGCCAGGCGG No data
Right 1076379576 10:130015799-130015821 TGGGGATTGGGGAGCAGGGGTGG No data
1076379561_1076379570 -7 Left 1076379561 10:130015770-130015792 CCAGTGGGCCTGGGGCCAGGCGG No data
Right 1076379570 10:130015786-130015808 CAGGCGGGCAGGCTGGGGATTGG No data
1076379561_1076379581 14 Left 1076379561 10:130015770-130015792 CCAGTGGGCCTGGGGCCAGGCGG No data
Right 1076379581 10:130015807-130015829 GGGGAGCAGGGGTGGGGGTTGGG No data
1076379561_1076379579 9 Left 1076379561 10:130015770-130015792 CCAGTGGGCCTGGGGCCAGGCGG No data
Right 1076379579 10:130015802-130015824 GGATTGGGGAGCAGGGGTGGGGG No data
1076379561_1076379578 8 Left 1076379561 10:130015770-130015792 CCAGTGGGCCTGGGGCCAGGCGG No data
Right 1076379578 10:130015801-130015823 GGGATTGGGGAGCAGGGGTGGGG No data
1076379561_1076379575 3 Left 1076379561 10:130015770-130015792 CCAGTGGGCCTGGGGCCAGGCGG No data
Right 1076379575 10:130015796-130015818 GGCTGGGGATTGGGGAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076379561 Original CRISPR CCGCCTGGCCCCAGGCCCAC TGG (reversed) Intergenic
No off target data available for this crispr