ID: 1076379565

View in Genome Browser
Species Human (GRCh38)
Location 10:130015778-130015800
Sequence CAGCCTGCCCGCCTGGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076379565_1076379578 0 Left 1076379565 10:130015778-130015800 CCTGGGGCCAGGCGGGCAGGCTG No data
Right 1076379578 10:130015801-130015823 GGGATTGGGGAGCAGGGGTGGGG No data
1076379565_1076379574 -6 Left 1076379565 10:130015778-130015800 CCTGGGGCCAGGCGGGCAGGCTG No data
Right 1076379574 10:130015795-130015817 AGGCTGGGGATTGGGGAGCAGGG No data
1076379565_1076379576 -2 Left 1076379565 10:130015778-130015800 CCTGGGGCCAGGCGGGCAGGCTG No data
Right 1076379576 10:130015799-130015821 TGGGGATTGGGGAGCAGGGGTGG No data
1076379565_1076379580 5 Left 1076379565 10:130015778-130015800 CCTGGGGCCAGGCGGGCAGGCTG No data
Right 1076379580 10:130015806-130015828 TGGGGAGCAGGGGTGGGGGTTGG No data
1076379565_1076379573 -7 Left 1076379565 10:130015778-130015800 CCTGGGGCCAGGCGGGCAGGCTG No data
Right 1076379573 10:130015794-130015816 CAGGCTGGGGATTGGGGAGCAGG No data
1076379565_1076379575 -5 Left 1076379565 10:130015778-130015800 CCTGGGGCCAGGCGGGCAGGCTG No data
Right 1076379575 10:130015796-130015818 GGCTGGGGATTGGGGAGCAGGGG No data
1076379565_1076379581 6 Left 1076379565 10:130015778-130015800 CCTGGGGCCAGGCGGGCAGGCTG No data
Right 1076379581 10:130015807-130015829 GGGGAGCAGGGGTGGGGGTTGGG No data
1076379565_1076379577 -1 Left 1076379565 10:130015778-130015800 CCTGGGGCCAGGCGGGCAGGCTG No data
Right 1076379577 10:130015800-130015822 GGGGATTGGGGAGCAGGGGTGGG No data
1076379565_1076379579 1 Left 1076379565 10:130015778-130015800 CCTGGGGCCAGGCGGGCAGGCTG No data
Right 1076379579 10:130015802-130015824 GGATTGGGGAGCAGGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076379565 Original CRISPR CAGCCTGCCCGCCTGGCCCC AGG (reversed) Intergenic
No off target data available for this crispr