ID: 1076379573

View in Genome Browser
Species Human (GRCh38)
Location 10:130015794-130015816
Sequence CAGGCTGGGGATTGGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076379557_1076379573 8 Left 1076379557 10:130015763-130015785 CCCTATCCCAGTGGGCCTGGGGC No data
Right 1076379573 10:130015794-130015816 CAGGCTGGGGATTGGGGAGCAGG No data
1076379558_1076379573 7 Left 1076379558 10:130015764-130015786 CCTATCCCAGTGGGCCTGGGGCC No data
Right 1076379573 10:130015794-130015816 CAGGCTGGGGATTGGGGAGCAGG No data
1076379551_1076379573 20 Left 1076379551 10:130015751-130015773 CCAAGCTCAGGGCCCTATCCCAG No data
Right 1076379573 10:130015794-130015816 CAGGCTGGGGATTGGGGAGCAGG No data
1076379560_1076379573 2 Left 1076379560 10:130015769-130015791 CCCAGTGGGCCTGGGGCCAGGCG No data
Right 1076379573 10:130015794-130015816 CAGGCTGGGGATTGGGGAGCAGG No data
1076379565_1076379573 -7 Left 1076379565 10:130015778-130015800 CCTGGGGCCAGGCGGGCAGGCTG No data
Right 1076379573 10:130015794-130015816 CAGGCTGGGGATTGGGGAGCAGG No data
1076379561_1076379573 1 Left 1076379561 10:130015770-130015792 CCAGTGGGCCTGGGGCCAGGCGG No data
Right 1076379573 10:130015794-130015816 CAGGCTGGGGATTGGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076379573 Original CRISPR CAGGCTGGGGATTGGGGAGC AGG Intergenic
No off target data available for this crispr