ID: 1076380306

View in Genome Browser
Species Human (GRCh38)
Location 10:130020788-130020810
Sequence CAGGAACACGAGGCTGTCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076380300_1076380306 29 Left 1076380300 10:130020736-130020758 CCTGCTGTCTTCTCTGAGCTGTT No data
Right 1076380306 10:130020788-130020810 CAGGAACACGAGGCTGTCATCGG No data
1076380303_1076380306 -4 Left 1076380303 10:130020769-130020791 CCTGCACTTGAAAAGCATGCAGG No data
Right 1076380306 10:130020788-130020810 CAGGAACACGAGGCTGTCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076380306 Original CRISPR CAGGAACACGAGGCTGTCAT CGG Intergenic
No off target data available for this crispr