ID: 1076386616

View in Genome Browser
Species Human (GRCh38)
Location 10:130061856-130061878
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076386607_1076386616 13 Left 1076386607 10:130061820-130061842 CCAGGGAGAAACAGTTCTGCACG No data
Right 1076386616 10:130061856-130061878 CAGGTAATCCCAGCAGGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076386616 Original CRISPR CAGGTAATCCCAGCAGGAGG CGG Intergenic
No off target data available for this crispr