ID: 1076386872

View in Genome Browser
Species Human (GRCh38)
Location 10:130063410-130063432
Sequence CGTGCCAAACAACCAAAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076386872_1076386876 11 Left 1076386872 10:130063410-130063432 CCCGGCTTTGGTTGTTTGGCACG No data
Right 1076386876 10:130063444-130063466 TTTGATCGAGTCATAGCTCTGGG No data
1076386872_1076386877 23 Left 1076386872 10:130063410-130063432 CCCGGCTTTGGTTGTTTGGCACG No data
Right 1076386877 10:130063456-130063478 ATAGCTCTGGGATCTTACCCAGG No data
1076386872_1076386875 10 Left 1076386872 10:130063410-130063432 CCCGGCTTTGGTTGTTTGGCACG No data
Right 1076386875 10:130063443-130063465 TTTTGATCGAGTCATAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076386872 Original CRISPR CGTGCCAAACAACCAAAGCC GGG (reversed) Intergenic
No off target data available for this crispr