ID: 1076386875

View in Genome Browser
Species Human (GRCh38)
Location 10:130063443-130063465
Sequence TTTTGATCGAGTCATAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076386869_1076386875 18 Left 1076386869 10:130063402-130063424 CCCTCTTTCCCGGCTTTGGTTGT No data
Right 1076386875 10:130063443-130063465 TTTTGATCGAGTCATAGCTCTGG No data
1076386867_1076386875 24 Left 1076386867 10:130063396-130063418 CCTTCTCCCTCTTTCCCGGCTTT No data
Right 1076386875 10:130063443-130063465 TTTTGATCGAGTCATAGCTCTGG No data
1076386872_1076386875 10 Left 1076386872 10:130063410-130063432 CCCGGCTTTGGTTGTTTGGCACG No data
Right 1076386875 10:130063443-130063465 TTTTGATCGAGTCATAGCTCTGG No data
1076386865_1076386875 30 Left 1076386865 10:130063390-130063412 CCAATACCTTCTCCCTCTTTCCC No data
Right 1076386875 10:130063443-130063465 TTTTGATCGAGTCATAGCTCTGG No data
1076386870_1076386875 17 Left 1076386870 10:130063403-130063425 CCTCTTTCCCGGCTTTGGTTGTT No data
Right 1076386875 10:130063443-130063465 TTTTGATCGAGTCATAGCTCTGG No data
1076386873_1076386875 9 Left 1076386873 10:130063411-130063433 CCGGCTTTGGTTGTTTGGCACGA No data
Right 1076386875 10:130063443-130063465 TTTTGATCGAGTCATAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076386875 Original CRISPR TTTTGATCGAGTCATAGCTC TGG Intergenic
No off target data available for this crispr