ID: 1076387928

View in Genome Browser
Species Human (GRCh38)
Location 10:130071912-130071934
Sequence TAGAATATGACGGCCAGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076387928_1076387931 2 Left 1076387928 10:130071912-130071934 CCGCGCCTGGCCGTCATATTCTA No data
Right 1076387931 10:130071937-130071959 TTTTCTACTAACAATGTTAAAGG No data
1076387928_1076387932 21 Left 1076387928 10:130071912-130071934 CCGCGCCTGGCCGTCATATTCTA No data
Right 1076387932 10:130071956-130071978 AAGGTTTTTCTTTCATATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076387928 Original CRISPR TAGAATATGACGGCCAGGCG CGG (reversed) Intergenic
No off target data available for this crispr