ID: 1076389705

View in Genome Browser
Species Human (GRCh38)
Location 10:130090256-130090278
Sequence ATGGAGGGACAACTGAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076389696_1076389705 21 Left 1076389696 10:130090212-130090234 CCTAGCTCATCTCATTGGGACTA No data
Right 1076389705 10:130090256-130090278 ATGGAGGGACAACTGAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076389705 Original CRISPR ATGGAGGGACAACTGAAGCA GGG Intergenic
No off target data available for this crispr