ID: 1076391897

View in Genome Browser
Species Human (GRCh38)
Location 10:130109721-130109743
Sequence GTGAGGAAAGAGATGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076391890_1076391897 14 Left 1076391890 10:130109684-130109706 CCTAAGTGGTACTGGCTTCACGG No data
Right 1076391897 10:130109721-130109743 GTGAGGAAAGAGATGGTGCAGGG No data
1076391894_1076391897 -9 Left 1076391894 10:130109707-130109729 CCAGGCAGTGAGTAGTGAGGAAA No data
Right 1076391897 10:130109721-130109743 GTGAGGAAAGAGATGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076391897 Original CRISPR GTGAGGAAAGAGATGGTGCA GGG Intergenic
No off target data available for this crispr