ID: 1076398744

View in Genome Browser
Species Human (GRCh38)
Location 10:130162798-130162820
Sequence AGGCCGCAGGGGTGGGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 582
Summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 521}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076398744_1076398754 1 Left 1076398744 10:130162798-130162820 CCTCAGGCCCACCCCTGCGGCCT 0: 1
1: 0
2: 4
3: 56
4: 521
Right 1076398754 10:130162822-130162844 AGCAACTTTGGGGACAAGTCAGG No data
1076398744_1076398751 -10 Left 1076398744 10:130162798-130162820 CCTCAGGCCCACCCCTGCGGCCT 0: 1
1: 0
2: 4
3: 56
4: 521
Right 1076398751 10:130162811-130162833 CCTGCGGCCTTAGCAACTTTGGG No data
1076398744_1076398752 -9 Left 1076398744 10:130162798-130162820 CCTCAGGCCCACCCCTGCGGCCT 0: 1
1: 0
2: 4
3: 56
4: 521
Right 1076398752 10:130162812-130162834 CTGCGGCCTTAGCAACTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076398744 Original CRISPR AGGCCGCAGGGGTGGGCCTG AGG (reversed) Intronic
900366761 1:2314794-2314816 AGGCTGCGGGGGGGAGCCTGAGG - Intergenic
900410329 1:2509749-2509771 AGGCCGCAGGGGCAGTCCTGAGG + Intronic
900428515 1:2591492-2591514 AGGCCACTGGGGTGGGGGTGAGG + Intronic
900642319 1:3693686-3693708 AGGCTGCATGGGTGGGATTGTGG - Intronic
900642338 1:3693756-3693778 AGGCTGCATGGGTGGGATTGTGG - Intronic
900642349 1:3693791-3693813 AGGCTGCAGGGCTGGGATTGCGG - Intronic
900642368 1:3693861-3693883 AGGCTGCATGGGTGGGATTGTGG - Intronic
900642380 1:3693896-3693918 AGGCTGCAGGGCTGGGATTGCGG - Intronic
900642402 1:3693967-3693989 AGGCTGCAGGGCTGGGATTGCGG - Intronic
900642453 1:3694142-3694164 AGGCTGCAGGGCTGGGATTGCGG - Intronic
900642465 1:3694178-3694200 AGGCTGCATGGGTGGGATTGCGG - Intronic
900642476 1:3694213-3694235 AGGCTGCAGGGCTGGGATTGCGG - Intronic
900642488 1:3694249-3694271 AGGCTGCATGGGTGGGATTGTGG - Intronic
900642510 1:3694320-3694342 AGGCTGCATGGGTGGGATTGCGG - Intronic
900642532 1:3694390-3694412 AGGCTGCAGGGCTGGGATTGCGG - Intronic
900642563 1:3694495-3694517 AGGCTGCAGGGCTGGGATTGCGG - Intronic
900642594 1:3694600-3694622 AGGCTGCAGGGCTGGGATTGCGG - Intronic
900642605 1:3694635-3694657 AGGCTGCATGGGTGGGATTGCGG - Intronic
900642616 1:3694670-3694692 AGGCTGCATGGGTGGGATTGCGG - Intronic
900642654 1:3694811-3694833 AGGCTGCATGGGTGGGATTGTGG - Intronic
900642683 1:3694916-3694938 AGGCTGCAGGGCTGGGATTGCGG - Intronic
900708780 1:4097630-4097652 GGGCCTCAGGGGTAGGCCTCAGG - Intergenic
900972892 1:6001230-6001252 AGGGCTCAGGGTAGGGCCTGGGG - Intronic
900980951 1:6045811-6045833 AGGCAGCAAGGGTAGGCCTGAGG + Intronic
901086416 1:6614421-6614443 AGGCCGGCGGGGAGGGGCTGGGG - Intronic
902509908 1:16960915-16960937 AGGCTGCAGAGCTGGGCCTGCGG + Exonic
902600249 1:17535992-17536014 AGGCTGCAGGTAGGGGCCTGGGG + Intergenic
902875586 1:19338968-19338990 AGGCCGCGGGGTGGGGGCTGGGG - Exonic
903067706 1:20710002-20710024 AGGAGGCAGGGGTAGGTCTGAGG - Intronic
903318382 1:22526630-22526652 AGGCCGCAGCAGCGGGCCTGTGG - Exonic
903472184 1:23594965-23594987 AAGCCACAGGGATGAGCCTGGGG + Intronic
903555103 1:24187366-24187388 AGGCGGCAGGGACGGGCCCGCGG - Intronic
903692352 1:25183579-25183601 AGGCAGCTGGGGTGGCCCTTAGG - Intergenic
903768451 1:25749437-25749459 AGGGGGCAGGGATGGGCCTGGGG + Intronic
904307375 1:29598908-29598930 GGGCCACGGGGGTGGGCCTATGG + Intergenic
905258093 1:36698362-36698384 AGCCCGCAGAGGTGGGGGTGAGG + Intergenic
905402568 1:37714402-37714424 AGGCTGCAGGTGTGGGCCAAAGG - Intronic
905517010 1:38569404-38569426 AGGTGGCAGGGCTGGGACTGGGG - Intergenic
905810197 1:40907260-40907282 AGGCCTCAGGGGCAGGCCTCAGG + Intergenic
905868463 1:41389235-41389257 AGGATGCAGGGGCGAGCCTGTGG - Intergenic
906641562 1:47444015-47444037 AGGGAGGAGGGGTGGGCCTGGGG - Intergenic
908165989 1:61459528-61459550 CGGCGGCAGGGACGGGCCTGGGG - Intronic
908409288 1:63846891-63846913 AGGCCGCTGTCCTGGGCCTGTGG - Intronic
911262475 1:95702215-95702237 AGTCCACTGGGATGGGCCTGGGG - Intergenic
912387932 1:109281826-109281848 AGAGCGCAGGCGAGGGCCTGGGG - Exonic
914847227 1:151289896-151289918 AGGCCTCAAGGGTGGGGGTGGGG + Exonic
915001945 1:152601629-152601651 AGGCATCAGGGTTGGGGCTGTGG + Intergenic
915079445 1:153341756-153341778 GGGCAGCAGGGCTGGGACTGTGG + Exonic
915737660 1:158094971-158094993 AGGCCAGAGGGTGGGGCCTGGGG - Exonic
917468699 1:175307567-175307589 AGGCCGCCGGGGTGAGGCTGGGG + Intergenic
919830787 1:201539027-201539049 AGGCAGCCGGCGTGTGCCTGGGG + Intergenic
919972955 1:202592391-202592413 AGGAGGCAGGGGTGGGGCTGGGG + Exonic
920697475 1:208192226-208192248 AGGGCCCAGAGGTGGGCCAGAGG - Intronic
921276342 1:213524406-213524428 AGGCCCCTGGGCTGGGGCTGGGG - Intergenic
922157078 1:223048950-223048972 AGGCCACAGGAGTGCGACTGTGG + Intergenic
922790351 1:228307713-228307735 CGGCCTCAGGGGTGGGCTTGAGG - Intronic
923663197 1:235976871-235976893 AGGCCGGAGGTGAGGGACTGTGG + Exonic
924772301 1:247088587-247088609 TGGCAGCAGGGTGGGGCCTGTGG - Intergenic
1062958264 10:1554240-1554262 CAGGGGCAGGGGTGGGCCTGTGG + Intronic
1064268795 10:13847238-13847260 CGGCCCCAGGGGTGGGACAGGGG + Intronic
1067665130 10:48271113-48271135 AGTCCAAAGCGGTGGGCCTGAGG - Intronic
1068629427 10:59284541-59284563 ATGTGGCAGGGGTGGGGCTGTGG - Intronic
1069661408 10:70126026-70126048 AGGGCCCAGGGGCTGGCCTGGGG + Intronic
1069749745 10:70737540-70737562 AGGCTGGTGGGGTGGCCCTGGGG - Intronic
1069916485 10:71790134-71790156 AGGCCCTGGGGGCGGGCCTGCGG - Intronic
1071527419 10:86366525-86366547 AGGGCGCAGGGGCGGGCGCGCGG - Intergenic
1071617988 10:87094262-87094284 AGGCCGGAGGGGAGGGCCGCAGG + Intronic
1073206313 10:101771105-101771127 CGGCCGAGGGGCTGGGCCTGCGG + Intronic
1074503071 10:114043787-114043809 AGGCCCCGGGGGTTGGCTTGGGG + Intergenic
1075413188 10:122244169-122244191 AGGGAGCAGGGGTGGGGATGGGG - Intronic
1075433465 10:122411227-122411249 AGGCTGGAGGATTGGGCCTGGGG + Intronic
1075622803 10:123940113-123940135 AGGCAGCAGGGGAGGGGTTGTGG - Intronic
1075719673 10:124577326-124577348 AGGCTGTATGGGTGGGCCAGGGG - Intronic
1075732486 10:124644745-124644767 TGGCAGCAGGGATGGGCATGGGG + Intronic
1076398744 10:130162798-130162820 AGGCCGCAGGGGTGGGCCTGAGG - Intronic
1076879860 10:133234818-133234840 AGGCCACAGGGGTGGGTGTTGGG + Intergenic
1077043085 11:533128-533150 AGGCCGGAGCGGTGACCCTGGGG - Intronic
1077232743 11:1465373-1465395 AGGCTCCAGGGGAGGACCTGTGG + Intergenic
1077405055 11:2379081-2379103 AGGTCCCAGGGCCGGGCCTGGGG - Intronic
1077408438 11:2392803-2392825 AGGAGGCTGGGGTGGGGCTGGGG + Intronic
1077556980 11:3230619-3230641 CCGCCTCAGGGGTGGGCATGGGG + Intronic
1079380459 11:19933393-19933415 TGGCTTCAGGTGTGGGCCTGGGG - Exonic
1080551965 11:33380152-33380174 AGCCGGCAGAGGAGGGCCTGGGG - Intergenic
1080578508 11:33622354-33622376 AGACCACAGGGCTGGCCCTGAGG + Intronic
1080581964 11:33651611-33651633 AGGCTGCAGGGGACAGCCTGTGG - Intronic
1081997419 11:47374540-47374562 TGGCCGCAGGGGTGGCCTTCAGG + Intronic
1082658056 11:55874590-55874612 CGGCCGGAGGGGTGGGCGGGGGG + Intergenic
1083087846 11:60168737-60168759 GGGCCCCAGGGTTGGGCTTGGGG - Intergenic
1083266345 11:61548579-61548601 AGAGCGCTGGGGTGGGCCTGGGG + Intronic
1083758416 11:64803242-64803264 AGGCCGCGGGGGCGGGGCTGAGG + Intergenic
1083888477 11:65584215-65584237 AGGACACAGGGGTGGGCTTAGGG - Intronic
1083963041 11:66025123-66025145 AGGCAGCAGGAGTTGGCATGGGG + Intronic
1084128821 11:67118592-67118614 AAGCCGCCGGGCTGGGCCCGCGG - Intergenic
1084267631 11:68013017-68013039 GTGCCGCGGGGGTGGGCTTGGGG + Intronic
1084307790 11:68298161-68298183 GGGGCTCAGGGGTGCGCCTGGGG + Intergenic
1084490678 11:69476583-69476605 AGCCCGCTGGGGTGGGCCGCTGG + Intergenic
1084598057 11:70128934-70128956 AGTCCACAGTGGTGGGACTGGGG - Intronic
1084961044 11:72716879-72716901 GGGGCCAAGGGGTGGGCCTGTGG + Intronic
1085739883 11:79069690-79069712 AGGCCGAGGGGGCGGGCCTCAGG - Intronic
1088613732 11:111602768-111602790 CGGCCGCAGTGGTGGGACCGGGG + Intronic
1088704585 11:112450394-112450416 AGAGGGCAGGGGTGGACCTGGGG - Intergenic
1089209821 11:116792301-116792323 TGGCCTCAGGGGAGAGCCTGGGG - Intronic
1089757406 11:120696715-120696737 CGGCAGCAGGGGTGGACCGGAGG + Intronic
1090045108 11:123324738-123324760 AGGTGCCAGGGGTGGGACTGGGG - Intergenic
1090309256 11:125720280-125720302 AAGCCTCAGGGGTGTGACTGAGG - Intergenic
1090352871 11:126118764-126118786 AGGTCGCAGGTGTGGGGGTGAGG + Intergenic
1090417620 11:126551373-126551395 AGGCCTCAGGGGCAGGCCTCGGG - Intronic
1090749469 11:129733212-129733234 TGGCCTCAGGGGTGGCCCAGAGG - Intergenic
1091747291 12:3000484-3000506 AGAGCGCAGGAGTGGGACTGGGG - Intronic
1092752151 12:11728673-11728695 AGGACGCAGGGCTGGACTTGAGG + Intronic
1094070979 12:26412523-26412545 AGGCCTCAGCTCTGGGCCTGGGG - Intronic
1094747037 12:33356965-33356987 AGGGCACAGGGGTGGTCCTTGGG + Intergenic
1094841375 12:34343997-34344019 GAGCCGCAGGGGTGGGCCAGGGG - Intergenic
1095672275 12:44875787-44875809 TGGCCGCAGAGCTGGGGCTGGGG - Intronic
1096519412 12:52175824-52175846 GGGCAGCAGAGGTGGGGCTGTGG - Intronic
1096674107 12:53217335-53217357 AGGACACAGTGGTGGGTCTGAGG - Intronic
1096740953 12:53693924-53693946 AGGCTGCAGCTGAGGGCCTGGGG - Intergenic
1097046172 12:56189236-56189258 AGGCCGCGGGGGAGGGGCTGGGG + Intronic
1097521717 12:60678980-60679002 AGGCCCCAGGTATGGGCATGGGG + Intergenic
1100540047 12:95548893-95548915 CCGGCGCAGGGGTGGGGCTGTGG - Intronic
1100820075 12:98422116-98422138 AGCCCTTAGGGGAGGGCCTGCGG + Intergenic
1100889023 12:99103081-99103103 AGGTAGGAGGGGTAGGCCTGGGG + Intronic
1101032272 12:100672138-100672160 TGGCCGCAGTGGTGGGCCACAGG + Intergenic
1101249429 12:102917361-102917383 GGGCCGGAGGGGAGGGGCTGAGG + Exonic
1102996172 12:117352267-117352289 AGGCAAGAGGCGTGGGCCTGGGG + Intronic
1103512389 12:121484219-121484241 AGGCGGCTGGGGAGGGGCTGAGG + Intronic
1103859791 12:124003109-124003131 CGCCTGCAGGGGTGGGGCTGTGG + Intronic
1103907828 12:124336302-124336324 AGGGAGCAGGGATGGGGCTGCGG - Intronic
1103919806 12:124393429-124393451 AGGCCACTGGGGAGGGGCTGGGG - Intronic
1103999151 12:124849342-124849364 AGGCTGCAGGGGTGTGCCGTGGG - Intronic
1104042964 12:125142452-125142474 GGGCCGCAGGTGTGGCACTGTGG + Exonic
1104895339 12:132161109-132161131 AGCTCTCAGGGGAGGGCCTGCGG - Intergenic
1104943865 12:132407106-132407128 TGGCTGCAGCTGTGGGCCTGGGG - Intergenic
1104974606 12:132546714-132546736 GGGCAGCTGGGGTGGGCCTGTGG - Intronic
1106563072 13:30863304-30863326 AGGTGGCTGGGGTGGGGCTGTGG - Intergenic
1107010140 13:35662305-35662327 TGGAGGCAGTGGTGGGCCTGAGG + Intronic
1107018859 13:35731269-35731291 AGGCCTCAGGGACGGGCCTCAGG - Intergenic
1107481401 13:40789222-40789244 AGCCCGCTGGGCTGGGACTGGGG - Intergenic
1107516877 13:41138003-41138025 AGGCCTCAGGGGCAGGCCTCAGG + Intergenic
1107746851 13:43519663-43519685 AGACCCCAGGAGTAGGCCTGAGG + Intronic
1108064813 13:46566044-46566066 GGGCCTCAGAGGAGGGCCTGGGG + Intronic
1110390918 13:74972952-74972974 AGGAGGCTGGGGTGGGCCAGAGG - Intergenic
1113128338 13:107006035-107006057 AGGAAGCAGGGGTGCTCCTGAGG + Intergenic
1113618296 13:111696196-111696218 AGGCCCCATGGGTGTGTCTGGGG - Intergenic
1113623827 13:111781457-111781479 AGGCCCCATGGGTGTGTCTGGGG - Intergenic
1113844374 13:113377862-113377884 AGGACGCGGGGGTGGGCTTCAGG - Intergenic
1113853117 13:113429130-113429152 GGGCCGCTTGGGAGGGCCTGGGG + Intronic
1113889174 13:113726996-113727018 AGGCCGCAGGCTGGGGCATGGGG - Intronic
1114671829 14:24415595-24415617 AGGCCGCGGGGGTGAGCAGGCGG - Exonic
1115163087 14:30417673-30417695 AGGCAGCAGGGGAGGGAATGAGG - Intergenic
1115431902 14:33329219-33329241 AGGCAGGTGGGGTGGGGCTGGGG - Intronic
1115761258 14:36580880-36580902 AGGCCGCAGGGCGGCACCTGGGG - Exonic
1117182214 14:53202486-53202508 AGGGAGCAGTGGTGTGCCTGTGG - Intergenic
1118370735 14:65135335-65135357 CAGCCTCAGGGTTGGGCCTGGGG + Intergenic
1119324737 14:73753148-73753170 AGGACTCAGCTGTGGGCCTGGGG - Intronic
1119398970 14:74349154-74349176 GGGTCACAGGGGTGGGCCTGAGG - Intronic
1119623596 14:76151882-76151904 GGGCCGGAGGGGTGGGGCGGTGG - Intergenic
1119877188 14:78071009-78071031 ATGCTGGAAGGGTGGGCCTGAGG - Intergenic
1120049378 14:79847496-79847518 AGGCCCCAGGGGTTGGCATGGGG - Intronic
1121009565 14:90512148-90512170 GGGGCCCAGGGCTGGGCCTGGGG + Intergenic
1121405495 14:93717025-93717047 AGGCCCCAGGAGGGGGCCAGTGG + Intergenic
1121535334 14:94686941-94686963 AGGCCAAAAGGGTGGGCCTGTGG - Intergenic
1122094470 14:99361210-99361232 GGGCCACAGGGGTGTGGCTGTGG + Intergenic
1122776654 14:104119874-104119896 AGGCCGGAGTGGAGGGGCTGGGG - Intergenic
1122885141 14:104707538-104707560 AGGGAGCAGGGGTGGGGGTGGGG - Exonic
1122885240 14:104707769-104707791 AGGCAGCAGGGGTGGGGGTGGGG - Exonic
1123018910 14:105388478-105388500 AGACGGCTGGGCTGGGCCTGTGG + Intronic
1123020438 14:105395487-105395509 ATGCTGCTGGGGTTGGCCTGAGG + Exonic
1123021255 14:105398829-105398851 AGGGCTCCGGGCTGGGCCTGGGG + Intronic
1123038131 14:105479553-105479575 AGGCCGCTGGGGTGGGTCGGGGG - Intronic
1123095700 14:105766078-105766100 AGGCCTCAGGGGCAGGGCTGTGG - Intergenic
1123710212 15:22980866-22980888 GGGCCGCAGGGGCCGGCCGGGGG - Intronic
1124001805 15:25766495-25766517 GGGCTGCTGGGCTGGGCCTGGGG - Intronic
1124414907 15:29466668-29466690 AGCCCCCAGGGGAGGGCCCGGGG + Intronic
1124415033 15:29466973-29466995 AGCCCCCAGGGGAGGGCCCGGGG + Intronic
1125091977 15:35803557-35803579 GGGCTGCAGGTGTGGGGCTGTGG - Intergenic
1125482629 15:40091041-40091063 AGGCCCCAGGATTGGTCCTGAGG - Exonic
1125919063 15:43514319-43514341 AGCCAGCAGGGGTGGGGCTGTGG - Intronic
1126693817 15:51309022-51309044 AGGCAGCAGAGGTGGGCTGGGGG + Intronic
1127347208 15:58112793-58112815 ATGCCACAGAGGTGGGCGTGAGG + Intronic
1128603653 15:69018242-69018264 AGGCTGCAGGGCCAGGCCTGGGG + Intronic
1128768547 15:70265623-70265645 AGGGGGCAGGGCTGGGCCTCGGG - Intergenic
1129091121 15:73152196-73152218 AGGCCTCAGGGGCAGGCCTTAGG + Intronic
1129207057 15:74043658-74043680 ATGCCACAGGGTAGGGCCTGGGG - Intronic
1129243413 15:74265295-74265317 GGGGCGGAGGGGTGTGCCTGAGG - Intronic
1129460906 15:75699699-75699721 AGGCGGGAGGGCTGGGCCGGGGG + Intronic
1129652118 15:77498482-77498504 AGCCCACTGGGGTGGGCATGGGG - Intergenic
1129682882 15:77667926-77667948 AGGGCCCAGGGCTGGGGCTGAGG + Intronic
1129884932 15:79031230-79031252 AGGCCCCTGGAGTGGTCCTGAGG - Intronic
1131544559 15:93305251-93305273 GGGCGGCAGGGGTGGTCTTGAGG + Intergenic
1132550456 16:551893-551915 AGGCCTCAGGGATGGGCCCCCGG + Intronic
1132753545 16:1470741-1470763 AGGCTGCGGGGGAGGGTCTGGGG - Intronic
1132945117 16:2528161-2528183 GGGCCCCAGGGGCGGGGCTGGGG + Intronic
1132997839 16:2832517-2832539 AGGCCCGCTGGGTGGGCCTGGGG - Intronic
1133031309 16:3012548-3012570 AGGCAGCTGGGGAGGGGCTGCGG + Exonic
1133213186 16:4274074-4274096 AGGAGCCAGGGGAGGGCCTGGGG - Intergenic
1134089568 16:11384375-11384397 AGGCAGCAGGGCTGGGGCTGGGG - Intronic
1134644712 16:15857093-15857115 AGGCCGAAGGGGTGGAGTTGGGG + Intergenic
1134910582 16:18022507-18022529 AGACCACAGGGGTTGGCATGGGG + Intergenic
1136029555 16:27492762-27492784 CGGCCGCAGGGGTCTGCATGTGG + Intronic
1136381227 16:29896895-29896917 AGGCCCAAGGGGAGGCCCTGGGG + Exonic
1136395080 16:29988102-29988124 GGTCCGAAGGGCTGGGCCTGGGG - Exonic
1136498722 16:30659297-30659319 AGCCCGCAGGGGGGGCCCTCGGG + Exonic
1136544700 16:30948613-30948635 AGGCCGGAGGGGTGGGGCCTGGG + Exonic
1136556499 16:31010504-31010526 CGGCCGCTGCGGGGGGCCTGCGG + Exonic
1136564435 16:31061569-31061591 CGGCAGCAGGGGCGGGGCTGGGG - Exonic
1137621688 16:49880552-49880574 AGGCCGGAGGGGTGGGTCCATGG - Intergenic
1138299294 16:55912880-55912902 AGCCCCCAGGTGTGGGCATGAGG + Intronic
1138611206 16:58126235-58126257 AAGCCTCATGGGTGTGCCTGTGG - Intronic
1138686395 16:58729816-58729838 AGGCTGGAGGGCTGGGGCTGAGG - Intronic
1139355380 16:66364422-66364444 GGGCCCCAGGGGTGGGGCTGGGG - Intergenic
1139356815 16:66371641-66371663 GGGCCTCAGGGGTGGGGCAGAGG - Intronic
1139573263 16:67826290-67826312 AGGCCCCAGGAGTGGGGCTTGGG + Intronic
1139650174 16:68358264-68358286 AGGCCTCAGGGGCACGCCTGGGG - Exonic
1141771616 16:86093102-86093124 AGGCCTCAGGGCTTGGGCTGTGG + Intergenic
1141774287 16:86111860-86111882 AGGTGGCAGGGCTGGGCCTCAGG - Intergenic
1141801311 16:86311258-86311280 TGGCAGCAGGCGTGGGCCTCAGG + Intergenic
1141993094 16:87621441-87621463 AGGCCACAGGACTGGGCCTGGGG + Intronic
1142054293 16:87983041-87983063 AGACAGCAGGGGTGGCACTGAGG - Intronic
1142123664 16:88399708-88399730 AGGCTGCAGGAGTGAGGCTGGGG - Intergenic
1142233558 16:88910954-88910976 CGGCCGCAGGGCAGCGCCTGAGG - Intronic
1142349348 16:89572802-89572824 AGGCAGTAGCAGTGGGCCTGGGG + Intergenic
1142539619 17:647994-648016 AGGCGGCAGGGGTGGGCCTCTGG + Intronic
1143019813 17:3911541-3911563 AGGCCGCAGGGATGGGAAGGGGG - Intronic
1143019826 17:3911588-3911610 AGCAGGCAGGGGTGGGCGTGGGG - Intronic
1143449518 17:7027497-7027519 AGGCCACAGGGGTCGCACTGTGG - Exonic
1143471129 17:7176955-7176977 AGGGCGCTGGGGCGGGGCTGGGG - Intronic
1143485631 17:7252146-7252168 TGGCCGCGGGGCGGGGCCTGAGG + Intronic
1143649856 17:8256709-8256731 AGGCCCCTGGAGTGGGCCTGGGG + Intronic
1143655186 17:8289687-8289709 AGGAAGCAGGAGTGGGCCAGAGG + Intronic
1143659273 17:8314857-8314879 GGGCAGCAGTGGTGGCCCTGGGG + Intronic
1144707697 17:17380437-17380459 AGGGGGAAGGGCTGGGCCTGAGG - Intergenic
1144872188 17:18378184-18378206 AGGAGGCAGGGGATGGCCTGGGG + Intronic
1145791898 17:27632554-27632576 AGGCCGCTGGTGGGGGCCTTAGG + Intronic
1145867513 17:28250481-28250503 AGCCCTCGGGGGTGGGCGTGCGG - Intergenic
1146577611 17:34008604-34008626 ATGCTGCAGGAATGGGCCTGAGG + Intronic
1146791105 17:35751061-35751083 AGGTGGCAGGGGTGAGACTGGGG - Intronic
1146912504 17:36657838-36657860 AGGACGCAGCGGGCGGCCTGCGG + Intergenic
1147163255 17:38579767-38579789 GGCCAGCAGGGCTGGGCCTGGGG - Intronic
1147752552 17:42745055-42745077 ACGGCGCAGGGGTGGGGCCGCGG - Intergenic
1148109661 17:45137333-45137355 AGCACCCAGAGGTGGGCCTGGGG - Intronic
1148838261 17:50478088-50478110 AAGGCGCAGGGGAAGGCCTGGGG - Intergenic
1150228727 17:63538358-63538380 ACGCGGCCGGGGTGGGGCTGGGG - Intronic
1151491801 17:74436124-74436146 ATGCTACAGGGGTGGGGCTGGGG - Intronic
1151667831 17:75555824-75555846 AGCTCGCAGGGGTGGCCATGAGG + Intronic
1152039625 17:77894452-77894474 AGGCAAAAGGGCTGGGCCTGGGG + Intergenic
1152231334 17:79115455-79115477 AAGCTCCAGGGCTGGGCCTGGGG + Intronic
1152273719 17:79341547-79341569 AGGCAGCATGGCTGGGGCTGGGG + Intronic
1152375107 17:79914880-79914902 AGGCAGGTGGGGTGGGCCAGGGG - Intergenic
1152461530 17:80444663-80444685 GGGCTGCAGGGGAGGGCGTGGGG + Intergenic
1152601285 17:81263494-81263516 AGCCGGCAGGGGTGCGCCCGGGG - Intronic
1152670277 17:81600000-81600022 AGCCAGCAGGGGTGCGGCTGGGG + Intronic
1153967211 18:10192697-10192719 AGGTCTCAGGGCTGGGCCAGGGG - Intergenic
1154383834 18:13875734-13875756 AGACCCCAGGGGTGGGGCTGCGG + Intergenic
1155086894 18:22467616-22467638 AGGGGGCTGGGGTGGGACTGGGG + Intergenic
1155839449 18:30628607-30628629 AGGCTGCAGGGCTGGACCTCGGG + Intergenic
1156327171 18:36085223-36085245 AGGTGGCAGAGCTGGGCCTGAGG + Intergenic
1157492923 18:48136657-48136679 AGCCCGCTGGCGTGGGCCGGCGG + Intronic
1159559865 18:69982624-69982646 TGGCTACAGGGGTGGGCCTGTGG - Intergenic
1160005991 18:75069380-75069402 AGGCGGGAGTGGTGGGCCTGGGG + Intergenic
1160251007 18:77203444-77203466 AGGCCGAGAGGATGGGCCTGTGG + Intergenic
1160496940 18:79381321-79381343 AGGCCCCTAGGGTGGGCCTTGGG + Intergenic
1160514452 18:79470782-79470804 AGGTCGCAGTGGTCGGCCTCCGG + Intronic
1160685538 19:434836-434858 GGGCCGGAGGAGTCGGCCTGGGG - Exonic
1160722609 19:604118-604140 AGGCCCCAGGGGTGGGGCTATGG + Intronic
1160722652 19:604241-604263 AGGCCCCAGGGGTGGGGCTATGG + Intronic
1160861734 19:1240111-1240133 AGGGAGCAGGGGAGGCCCTGGGG - Intergenic
1160940453 19:1618303-1618325 AGGCCACAGGGCTGGTCCAGGGG - Intronic
1160983654 19:1827784-1827806 AGGCCGAGGGGGGCGGCCTGCGG - Exonic
1161073845 19:2275618-2275640 AGGAGGCAGGGCTGGGGCTGAGG - Exonic
1161171365 19:2813933-2813955 AGGCAGCCGGGGCGGGGCTGGGG + Exonic
1161199418 19:3006236-3006258 AGGCCAAAGGGGTGGGGCTCTGG - Intronic
1161619903 19:5292551-5292573 TGGCCTCAGGGAGGGGCCTGTGG - Intronic
1162064911 19:8119427-8119449 AAGGCCCTGGGGTGGGCCTGAGG - Intronic
1162625177 19:11879605-11879627 TGGCAGCTGGTGTGGGCCTGTGG - Intronic
1162635331 19:11963653-11963675 TGGCAGCTGGTGTGGGCCTGTGG - Intronic
1162929849 19:13952454-13952476 AGGCGGCAGGGGTGGGGCGAAGG + Intronic
1162940355 19:14005806-14005828 AGCGCGAAGGGGCGGGCCTGGGG - Intronic
1163117150 19:15195686-15195708 GGGCCGCAGTGGTCGCCCTGCGG - Intronic
1163163639 19:15480452-15480474 AGGCCCCAGGGGTGGCCCCCAGG - Intronic
1163266648 19:16226189-16226211 AGGCTGGAGGGGTGAGCCTGGGG + Intronic
1163288459 19:16363935-16363957 AGGCCGCAAGGGTGGGCTGCAGG - Intronic
1163408961 19:17141491-17141513 AGGCAGCAGAGCTGGTCCTGGGG - Intronic
1163410758 19:17152863-17152885 AGGCCACAGGGGCAGGTCTGGGG - Intronic
1163577142 19:18117641-18117663 AGGACGCTGGGGTGGGTCTTGGG + Intronic
1163636996 19:18441610-18441632 AGGCTACAGGAGTGGGGCTGGGG - Intergenic
1163648612 19:18504197-18504219 AGGCTGGAGGGGTGAGGCTGAGG + Intronic
1164524726 19:29004993-29005015 AGGCTGCGGGGATGGGCCGGCGG - Intergenic
1164788963 19:30959766-30959788 AAGGTGCAGGGATGGGCCTGTGG + Intergenic
1165058541 19:33194202-33194224 AGGCGGCTGGGGCGGGCCGGGGG - Intronic
1165433224 19:35783999-35784021 AGGCAGGAGGGGCGGGTCTGGGG + Intronic
1166016517 19:39984181-39984203 AGTCAGCAGGGGTTGGCCTTAGG + Intronic
1166230969 19:41425715-41425737 AGGAAGCCTGGGTGGGCCTGGGG + Exonic
1166873148 19:45882830-45882852 AGGCCGCAGGGGTGGGGGCTGGG + Intergenic
1166930652 19:46299229-46299251 AGGCAGCAGGGGTGTGACGGGGG + Intronic
1167148037 19:47694392-47694414 AGGCGGCTGCGGCGGGCCTGGGG - Exonic
1167383738 19:49152437-49152459 AGGGTGCAGGGGTGGGCCAGGGG - Intronic
1167396835 19:49235030-49235052 GGGCAGCAGGGATGGGGCTGGGG + Intergenic
1167422948 19:49414676-49414698 AGGCAGCACGGACGGGCCTGGGG - Intronic
1167422959 19:49414705-49414727 AGGCAGCACGGACGGGCCTGGGG - Intronic
1167422970 19:49414734-49414756 AGGCAGCACGGACGGGCCTGGGG - Intronic
1167422981 19:49414763-49414785 AGGCAGCACGGACGGGCCTGGGG - Intronic
1167422992 19:49414792-49414814 AGGCAGCACGGACGGGCCTGGGG - Intronic
1167423003 19:49414821-49414843 AGGCAGCACGGACGGGCCTGGGG - Intronic
1167513682 19:49910399-49910421 AGAGTGCAGGTGTGGGCCTGGGG - Intronic
1168403687 19:56100026-56100048 AGGCCACAGGGCTGGGGCCGTGG + Intronic
1168494484 19:56838290-56838312 CGGCCCCAGGGGCGGGCATGAGG - Intronic
925592740 2:5526422-5526444 GGGGCCCAGGGTTGGGCCTGGGG - Intergenic
925971559 2:9110108-9110130 AGACCGCAGGGCTGGGCCTTCGG - Intergenic
926041340 2:9675716-9675738 AGGTCGCAGGGCGGGGCCTTGGG + Intergenic
926244840 2:11115182-11115204 GGGAGGCTGGGGTGGGCCTGAGG + Intergenic
927143423 2:20145068-20145090 TGGCCTCAGGGCTGGGACTGGGG - Intergenic
927222696 2:20728645-20728667 AGGAGGCAGGGGTGGCACTGGGG + Intronic
927694083 2:25228877-25228899 AGGCCGCTAGGCTGGGGCTGAGG + Exonic
927826236 2:26311920-26311942 AAGGCGAAGGGGTGGTCCTGTGG + Exonic
928919611 2:36512968-36512990 AGGCAGCAGGGCTGGAGCTGGGG - Intronic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
932306181 2:70705573-70705595 AGGCCGAAGGGTGGGCCCTGTGG - Intronic
932597479 2:73103079-73103101 AGACAGCAGGGGTTGGCTTGAGG - Intronic
932751475 2:74374246-74374268 AGGCTGCTGGGGTGGGGGTGGGG - Intronic
932845265 2:75128592-75128614 ACCCCTCAGGGGTGGGACTGGGG + Intronic
933592395 2:84247448-84247470 AGGTCACAGGTGTGGGCATGAGG - Intergenic
933695710 2:85215749-85215771 AGGCTGCTGGGGTGGGGGTGGGG + Intronic
934716928 2:96549901-96549923 GGGACGCAGGGGTAGGACTGGGG - Intronic
934973945 2:98787179-98787201 AGGGCTCAGGGGTGGGGCTGGGG + Intergenic
937096808 2:119240874-119240896 AGGCCGCAGGGACAGGCCTCTGG + Intronic
937155662 2:119717103-119717125 GGGCCTCAGGGGTGGGGCAGAGG + Intergenic
939986211 2:148831978-148832000 AGGAGGCAGGGCTGGGCGTGAGG + Intergenic
941580595 2:167292753-167292775 GGCCCGCAGGGGTGGGCCTGGGG - Intergenic
942067289 2:172283773-172283795 AGGCCTCGGGGGTGGGGCCGGGG + Intergenic
946189831 2:218002420-218002442 AGGAGGCAGTGGTGGGGCTGGGG - Intronic
947586612 2:231360633-231360655 AGCCCGCAGGGCCTGGCCTGGGG + Intronic
947837837 2:233188239-233188261 AGGCAACAGGGGTGGGGCGGGGG - Intronic
948387604 2:237591299-237591321 GGGTAGCAGGGTTGGGCCTGAGG + Intronic
948665819 2:239534238-239534260 AGGGAGCAGGTGTGGGACTGGGG - Intergenic
948912724 2:241012414-241012436 AGGCCGGAGGGGCTGCCCTGGGG - Intronic
948921018 2:241065936-241065958 GGGCCGCGGGGGTGGGCTTGGGG + Intronic
949069874 2:242018056-242018078 GGGACGCAGGGGAGGGGCTGGGG + Intergenic
949069883 2:242018076-242018098 GGGACGCAGGGGAGGGGCTGGGG + Intergenic
949069892 2:242018096-242018118 GGGACGCAGGGGAGGGGCTGGGG + Intergenic
1168966871 20:1904110-1904132 TGGCTGCAGGGGGGGGACTGTGG - Intronic
1169116942 20:3072071-3072093 GGGCCGCAGGGGAGGCACTGCGG - Exonic
1169118729 20:3083162-3083184 GGGCCGCAGGGGAGGCACTGCGG + Exonic
1169124318 20:3116134-3116156 AGGCCGCTGGGGAGGGAATGGGG - Intronic
1169208740 20:3754194-3754216 GGGCCGCATGGGTGGGGCCGGGG - Intronic
1170569145 20:17623035-17623057 AGGCCTCAGTGGTGGTCGTGAGG - Intronic
1170584353 20:17723157-17723179 GGGCTGCAGGGGTGGGGCTGGGG - Intronic
1170971123 20:21117497-21117519 TGGAAGCTGGGGTGGGCCTGTGG - Intergenic
1172167495 20:32907938-32907960 TGGCAGCAAGGGAGGGCCTGGGG + Intronic
1172528904 20:35617406-35617428 AGGGGCCGGGGGTGGGCCTGGGG - Intronic
1172583459 20:36065813-36065835 AGGCAGCAGGGGTGGGACTTCGG + Intergenic
1172740882 20:37165991-37166013 AGCCCCCATGTGTGGGCCTGTGG + Intronic
1173184659 20:40831292-40831314 AGGCCCCAGAGGTGGGTCAGGGG - Intergenic
1173831224 20:46089853-46089875 AGGCGGCAGCGGCGGGCCTGAGG - Exonic
1175387834 20:58608589-58608611 GGGTCGCATGTGTGGGCCTGGGG + Intergenic
1175785620 20:61710041-61710063 GGGCGGCCAGGGTGGGCCTGGGG + Intronic
1175972166 20:62692146-62692168 AGGCCCCAGGGGTGGGTCTTGGG - Intergenic
1175999996 20:62827400-62827422 GGGCTGCCTGGGTGGGCCTGGGG + Intronic
1176161318 20:63650426-63650448 CGGCGGGAGGGGTGGGCGTGAGG - Intronic
1176161337 20:63650482-63650504 CGGCGGGAGGGGTGGGCGTGAGG - Intronic
1176161412 20:63650695-63650717 GGGCGGGAGGGGTGGGCGTGAGG - Intronic
1176161434 20:63650752-63650774 CGGCGGGAGGGGTGGGCGTGAGG - Intronic
1176161453 20:63650808-63650830 CGGCGGGAGGGGTGGGCGTGAGG - Intronic
1176178138 20:63738171-63738193 AGGCCGCAGGGCTGGGGGTGGGG - Exonic
1176203256 20:63873828-63873850 AGCCCCCAGGGGTGCGCCTGGGG - Intronic
1179544479 21:42105225-42105247 GGGCTGCAGGGTAGGGCCTGAGG + Intronic
1179641587 21:42751244-42751266 GGGCCACAGGGCTGGGCGTGGGG - Intronic
1179802440 21:43817275-43817297 AGGCCCCAGGGCTGGGCCCCAGG - Intergenic
1180101712 21:45590673-45590695 AGGCAGGAGGGGCGGGGCTGAGG + Intergenic
1180101720 21:45590693-45590715 AGGCAGGAGGGGCGGGGCTGAGG + Intergenic
1180128010 21:45805176-45805198 AGGCCACAGGGGTGTGGCTGTGG - Intronic
1180248230 21:46562574-46562596 GGGCAGCAGGGGTGAGACTGCGG + Intronic
1180842560 22:18966111-18966133 AGGCCGGCTGGGTGGGGCTGGGG - Intergenic
1180949709 22:19715495-19715517 AGGCCCCTGGGGTGGGGCGGGGG + Intronic
1180965279 22:19784900-19784922 AGCCAGCAGGGGTGGCCTTGGGG - Exonic
1181055354 22:20258313-20258335 GGGTGGCAGGGGTGGGGCTGGGG - Intronic
1181433079 22:22894663-22894685 AGGCTGCTGGGGTGGGCCTGGGG + Intronic
1181541206 22:23574172-23574194 AGGCTGCTGGGGTGGGCATGGGG - Intronic
1181551103 22:23639527-23639549 AGGCTGCTGGAGTGGGCATGGGG - Intergenic
1181797177 22:25319158-25319180 AGGCTGCTGGGGTGGGCATGGGG + Intergenic
1181802025 22:25354015-25354037 GTGCAGCAGGGATGGGCCTGGGG - Intronic
1182423057 22:30257794-30257816 TGACCGCAGGGGTCGGCCTTAGG + Intergenic
1182427655 22:30283456-30283478 AGCCCGCAGTGGTGCACCTGTGG + Intergenic
1182435300 22:30326339-30326361 TGGCGGCAGGGGTGGGTTTGGGG + Intronic
1182659813 22:31917248-31917270 AGGAGGCAGGGTGGGGCCTGGGG + Intergenic
1183073828 22:35414032-35414054 AGGCTGCAGGGCAGGGCCTCTGG + Intronic
1183317214 22:37143277-37143299 AGGCTGCAGTGGAGGGGCTGGGG - Intronic
1183371672 22:37436025-37436047 AGGCCGTAAGTCTGGGCCTGTGG - Intergenic
1183412897 22:37665889-37665911 AGTGGGGAGGGGTGGGCCTGTGG - Exonic
1183507013 22:38214896-38214918 AGGCCGGAGGGGCGTGGCTGAGG - Exonic
1183577507 22:38701145-38701167 AGGCCGTGGGTGTGGGGCTGCGG + Intronic
1183688555 22:39375647-39375669 AGGCATCAGGGGTGGACCGGGGG + Intronic
1183859658 22:40660601-40660623 AGGGAGCTGGGGTGGGACTGAGG + Intergenic
1184034596 22:41912470-41912492 AGGCCACAGAGGTGAGCCTCTGG - Intronic
1184388933 22:44192119-44192141 AGGGCCCATGGGTGGGGCTGGGG + Intronic
1184411817 22:44330517-44330539 TGGCCCCAGGGGTGAGGCTGGGG + Intergenic
1184453234 22:44595085-44595107 AGACCTGAGGGCTGGGCCTGCGG + Intergenic
1184667428 22:45996392-45996414 AGCAGGCAGGGCTGGGCCTGAGG + Intergenic
1184730040 22:46366898-46366920 GGGCCGCAGGACTGGGGCTGAGG + Intronic
1184806562 22:46798396-46798418 AGGGGGCAGGGGTGAGGCTGGGG + Intronic
1185046503 22:48531186-48531208 AGGCCGAAAGGGTTGGCCAGGGG - Intronic
1185047218 22:48534525-48534547 AGGCTGGAGGGCAGGGCCTGAGG + Intronic
1185098077 22:48822413-48822435 GGGTCCCATGGGTGGGCCTGTGG - Intronic
1185146742 22:49141259-49141281 AGGACACAGGGGTAGGTCTGTGG + Intergenic
1185146786 22:49141509-49141531 AGGCCTCAGGGGTGGGCAGGGGG - Intergenic
1185171066 22:49294938-49294960 AGGGAGCAGGGCTGGGACTGCGG + Intergenic
1185251030 22:49801841-49801863 AGGCAGCTGGGGGTGGCCTGGGG - Intronic
1185276439 22:49951969-49951991 GGGCCTCAGTGGAGGGCCTGCGG - Intergenic
1185279698 22:49964797-49964819 AGGCCCCTGGGGTGGGGGTGGGG - Intergenic
1185399202 22:50607256-50607278 AGGACGCCTGAGTGGGCCTGGGG + Intronic
950404624 3:12796933-12796955 ACGAGGCAGGAGTGGGCCTGTGG - Intronic
950528519 3:13539088-13539110 AGGCCTCACGGGGGAGCCTGTGG - Intergenic
950580721 3:13860303-13860325 AGGGAGCTGGGGTGGGGCTGAGG - Intronic
950829521 3:15859947-15859969 AAGCCGCAAGGGTGGGCGCGGGG + Intergenic
951744396 3:25961231-25961253 GGGCCGCAGGAGAGGACCTGGGG + Intergenic
954107981 3:48419533-48419555 AGGCCTCAGGGGAGGGGATGTGG - Intronic
954439988 3:50516569-50516591 CTGGCCCAGGGGTGGGCCTGGGG - Intergenic
954629268 3:52039405-52039427 AGGAGGCAGGGCTGGGCATGGGG + Intergenic
956538939 3:70312568-70312590 AGGCCCAAGGTGTGGGACTGGGG + Intergenic
956715038 3:72071771-72071793 AGTTCTCAGGGGTGGGGCTGGGG - Intergenic
957066551 3:75527695-75527717 AAGCCACAGGAGTGGGGCTGTGG - Intergenic
958942370 3:100330779-100330801 AGGCCTCAGGGGCAGGCCTCAGG + Intergenic
959389766 3:105759521-105759543 AGGCCGACGGGGTTGGGCTGAGG - Intronic
960394245 3:117117025-117117047 AGGCCCCAGGGGAGGAGCTGTGG - Intronic
961286601 3:125810353-125810375 AAGCCACAGGAGTGGGGCTGTGG + Intergenic
961322283 3:126084133-126084155 AGGACGCAGGGGCGGGCCTGCGG + Exonic
961780443 3:129317394-129317416 AGGGCACAGGAGTGGGGCTGGGG + Intergenic
963256208 3:143147339-143147361 ATGCCTCAGGGGTGGGCATCAGG - Intergenic
963316568 3:143765173-143765195 AGGGAGGAAGGGTGGGCCTGAGG - Intronic
963741592 3:149086734-149086756 AGGCCCCAGGAGTGCGACTGCGG + Intergenic
966645990 3:182246847-182246869 AGACCACAGGAGTGGGCCTTGGG + Intergenic
967557107 3:190873308-190873330 AGAAGGCAGGGGTGGGACTGGGG - Intronic
968068494 3:195772007-195772029 AGGACGCAAGGGATGGCCTGAGG - Intronic
968106803 3:196007108-196007130 GGGACGCAGGGGAGGGGCTGGGG - Intergenic
968440822 4:623681-623703 AGGGCCCTGGGGTGGGGCTGGGG - Intergenic
968515746 4:1014983-1015005 GGGCCGCAGCGCGGGGCCTGCGG - Intronic
968566674 4:1316993-1317015 TGGGGGCCGGGGTGGGCCTGGGG - Intronic
968566700 4:1317065-1317087 TGGGGGCCGGGGTGGGCCTGGGG - Intronic
968566725 4:1317137-1317159 TGGGGGCTGGGGTGGGCCTGCGG - Intronic
968566761 4:1317248-1317270 TGGGGGCTGGGGTGGGCCTGCGG - Intronic
968606232 4:1537003-1537025 AGGCTGCAGGGATGGGTCTGGGG - Intergenic
968730946 4:2268929-2268951 TGTCCGCTGGGGTGGGCGTGGGG + Intergenic
969113555 4:4858125-4858147 TGGCGGCAGGGGTCGGGCTGCGG - Intergenic
969477253 4:7428651-7428673 AAGGCCCTGGGGTGGGCCTGGGG + Intronic
969604989 4:8197907-8197929 AGGACGCAGGTGTGGGCTGGAGG + Intronic
969637326 4:8376914-8376936 AGGCCTCAGGTGGGAGCCTGAGG - Intronic
971221950 4:24716877-24716899 AGCCTGCAAGGGTGGGCCTAGGG + Intergenic
973246747 4:48017381-48017403 GGGCCGCGGGGGTGGGCGTTGGG + Intronic
975669556 4:76767195-76767217 ACACTGCAGGGGTGGCCCTGAGG - Intronic
979990235 4:127366746-127366768 AGGCCTCAGGGCCAGGCCTGAGG - Intergenic
980982471 4:139666234-139666256 AGGCGGCATGGGTGACCCTGAGG - Intronic
983907994 4:173205280-173205302 AGTCTGCAGGGTTGGTCCTGGGG + Intronic
984255231 4:177382216-177382238 AGGAGGCAGAGCTGGGCCTGGGG - Intergenic
985566395 5:620477-620499 AGGGCGCAGGGCTGGGGCCGTGG + Intronic
985988770 5:3538469-3538491 AGGATGCAGGGGTGGGGCTGTGG - Intergenic
986195272 5:5532517-5532539 GGGCTGTAGAGGTGGGCCTGGGG - Intergenic
990178610 5:53135518-53135540 AGGAGGCAGGGATGGGCCTGAGG - Intergenic
990954906 5:61331890-61331912 GGGCCGCCGGGCCGGGCCTGAGG - Intergenic
991475180 5:67011224-67011246 AGGCTGCAGGGGAGGGGCTGGGG - Intronic
992086029 5:73279173-73279195 AAGAGACAGGGGTGGGCCTGTGG - Intergenic
995349312 5:111156789-111156811 AGAGAGCAGGTGTGGGCCTGTGG - Intergenic
998137830 5:139683752-139683774 AGGCCGCAGGGGGCCCCCTGGGG - Exonic
998153267 5:139769306-139769328 AGGCCTCAGGGATAGGGCTGTGG + Intergenic
998214697 5:140228389-140228411 AGGCTTCAGGGGTGGGGCTCAGG + Intronic
998227716 5:140339789-140339811 AGGCTGCTGTGGTGAGCCTGAGG - Intronic
998353037 5:141513474-141513496 AGGCAGCGGGGGTGGGGGTGCGG - Intergenic
998370224 5:141656016-141656038 AGGGTGCAGAGGTGGGCCAGAGG + Intronic
999321080 5:150615430-150615452 AGGCAGAAGGAGTGGGCGTGGGG - Intronic
999398116 5:151243701-151243723 AGGCGGATGGGGTGTGCCTGTGG + Intronic
999448943 5:151664245-151664267 AGGAGGCAGGGGAGGGCCTGAGG + Intronic
999759163 5:154687045-154687067 AAGAGGCAGGGGTGGGTCTGGGG + Intergenic
1000071459 5:157744124-157744146 GGGCCGCAGGAGCGGGCCGGAGG + Exonic
1001399265 5:171437133-171437155 AGGCCCCAGCCTTGGGCCTGGGG + Intronic
1002432759 5:179212733-179212755 AGTGGGCAGGTGTGGGCCTGAGG + Intronic
1002465750 5:179407602-179407624 AGGCAGCAGGGCTGGGCTTGTGG + Intergenic
1002877810 6:1226767-1226789 AGGCTGCCGGGGTGGGCCATGGG + Intergenic
1002898881 6:1394247-1394269 AGGCCGCAGTGGTGTTTCTGGGG + Intronic
1003923534 6:10855762-10855784 GGGTAGCAGGGGTGGGCGTGTGG - Intronic
1006249036 6:32765123-32765145 AGGAAGAAGGGGTGGGCCAGAGG - Intergenic
1006361820 6:33591009-33591031 AGGCCTGTGGGGTGGGCCCGAGG + Intergenic
1006642021 6:35494543-35494565 GGGTCCCAGGGGTGGCCCTGAGG - Intronic
1007063848 6:38969619-38969641 ATGAGGCTGGGGTGGGCCTGGGG + Intronic
1007283906 6:40733841-40733863 AGGCTGCAGAGGTGGGCAGGAGG - Intergenic
1007372073 6:41432530-41432552 AGGAGGCTGGGGTGGGCCAGGGG - Intergenic
1007775726 6:44223474-44223496 GGGTGGCAGGGGTGGGCCGGGGG + Intronic
1007816959 6:44531460-44531482 AGGCTGGAGTGGTGGTCCTGAGG + Intergenic
1012476699 6:99621515-99621537 AGGGGGCAGAGGTGGGGCTGGGG + Intergenic
1012953261 6:105541379-105541401 AGGCCTCAGGGGCAGGCCTCAGG + Intergenic
1013459087 6:110358238-110358260 AGGCCGCCCGGGAGGGGCTGCGG - Exonic
1014046326 6:116892424-116892446 AGGCCCAAGAAGTGGGCCTGGGG - Intronic
1016036477 6:139388647-139388669 TGGCTGCTGGGGTGGGGCTGGGG - Intergenic
1016346270 6:143117242-143117264 AGGAGGCAGGGAAGGGCCTGTGG + Intronic
1016688254 6:146905757-146905779 AGGCTGCAGCAGTGGCCCTGGGG + Intergenic
1017181942 6:151562857-151562879 AGGCCTTAGGGGAGGGGCTGGGG + Intronic
1019314454 7:377967-377989 AGGCCGCAGGGCTGTGAGTGGGG - Intergenic
1019330433 7:458150-458172 TGGCCGCAGCCGTGGACCTGAGG - Intergenic
1019415162 7:923701-923723 AGGCCGCAGGGCATGGCGTGGGG + Intronic
1019472819 7:1230236-1230258 AGGGCGCGGGGGAGGGCGTGGGG + Intergenic
1019479583 7:1260324-1260346 GGGCCGGATGGGTGAGCCTGGGG - Intergenic
1019493477 7:1325644-1325666 AGGCCGGGGGGCTAGGCCTGGGG - Intergenic
1019575213 7:1734516-1734538 AGGGCTCAGGGCTGGGGCTGGGG - Intronic
1019732394 7:2635161-2635183 AGCTGGCAGGGCTGGGCCTGAGG + Intronic
1019738636 7:2662293-2662315 CGGCAGGAGGGGTGAGCCTGTGG - Exonic
1020137765 7:5596140-5596162 AGTCTGCAGGGGTGGGCGTGGGG + Intronic
1021125914 7:16851094-16851116 TGGCAGCAGGGCTGGCCCTGAGG + Intergenic
1022831667 7:34073840-34073862 AGGCAGCAGGGGTGTTGCTGTGG + Intronic
1023990651 7:45126385-45126407 AGGCGGCAGGTGGTGGCCTGAGG + Intergenic
1024042128 7:45564006-45564028 AGGCAGCAGCGGTGGGCAAGGGG + Intergenic
1024044207 7:45576023-45576045 GGGCCGCAGGGATGGGGCTGGGG + Intronic
1027237046 7:76304183-76304205 CGGCAGCAGGGGTGGGCATCCGG - Exonic
1027512110 7:79096015-79096037 AGGGGGCAGGGCTGTGCCTGAGG + Intronic
1028437965 7:90827061-90827083 AGGCAGCAGGGGTGGGGTGGGGG - Intronic
1029450995 7:100641742-100641764 AGGAGGCAGGCGTGGGGCTGTGG - Exonic
1029707292 7:102282654-102282676 GGGCTGCAGGGGTGGCCTTGAGG + Intronic
1030232301 7:107221269-107221291 AGACCCCAGGGGTGGGGGTGGGG + Intronic
1032023459 7:128422881-128422903 AGCCAGCAGGGGAGGGTCTGGGG + Intergenic
1032086111 7:128884751-128884773 AGGGCACAGTGGTGGGGCTGGGG - Intronic
1033304994 7:140218694-140218716 AGGACTCTGGGGTGGGCCTTGGG + Intergenic
1034546641 7:151793887-151793909 AGGCAGCAGGGGAGGGCCAGTGG + Intronic
1034948005 7:155276538-155276560 AGGCTGAAGCTGTGGGCCTGTGG - Intergenic
1035039868 7:155919770-155919792 CGGCAGCAGGGGTGGGCCTCAGG + Intergenic
1035828787 8:2672642-2672664 CGGTCTCAGGGTTGGGCCTGGGG - Intergenic
1037341280 8:17848250-17848272 AGGCTTCATAGGTGGGCCTGGGG - Intergenic
1041107897 8:54459316-54459338 AGGCAGCAGCGGCGGGCCGGCGG - Exonic
1041330253 8:56716504-56716526 GAGCAGCAGGGGTGGGGCTGGGG - Intergenic
1045259619 8:100560602-100560624 AGCCTGCAGGTGTGGGCCAGGGG - Intergenic
1048456143 8:134579983-134580005 AGGCCACAGGGTTCAGCCTGTGG - Intronic
1049278016 8:141729582-141729604 AGGCAGGATGGATGGGCCTGGGG - Intergenic
1049352329 8:142170899-142170921 AGGCGGCATGGTTGGACCTGAGG - Intergenic
1049379586 8:142305339-142305361 AGGGCGCAGGGGTGGGAGGGGGG + Intronic
1049396403 8:142403078-142403100 AGGCGGCGGCGGTGGGGCTGGGG - Intronic
1049807143 8:144546240-144546262 AGGCTGGAGGGAAGGGCCTGGGG - Intronic
1051609936 9:18951275-18951297 AGACCTCAGGGGAGGACCTGGGG - Intronic
1053240092 9:36487897-36487919 GCGCCTCAGGGGCGGGCCTGGGG - Intergenic
1053351842 9:37418385-37418407 AGGCCGAAGGGCCTGGCCTGGGG - Intergenic
1053358771 9:37468248-37468270 AGTCAGCAGGAGTCGGCCTGAGG - Intergenic
1055054081 9:72007849-72007871 CGGCAGCAGGGGTGGGCATCCGG + Intergenic
1057146689 9:92763858-92763880 AGGACACAGCGCTGGGCCTGGGG + Intronic
1057178009 9:93013331-93013353 AGAACGCAGAGGTGAGCCTGCGG - Intronic
1057206312 9:93175044-93175066 AGCACACAGGGTTGGGCCTGGGG + Intergenic
1057218191 9:93241107-93241129 AGGCAGCAGTGTTGGCCCTGGGG - Intronic
1057686796 9:97241881-97241903 AGGCAGAAGGGGGGGGCCTTAGG + Intergenic
1057928112 9:99170749-99170771 GGGGAGCAGGGGTGGGGCTGGGG + Intergenic
1058058723 9:100473841-100473863 GGGTCCCAGGGGTGGGCCCGAGG + Intronic
1058870199 9:109194790-109194812 AGGCTGCAGGGAGGGGCTTGGGG - Intronic
1060596417 9:124851841-124851863 TGGCCGAAGGGGTGGAGCTGGGG - Intergenic
1060658330 9:125388044-125388066 GAGCCTCTGGGGTGGGCCTGGGG + Intergenic
1060766186 9:126296393-126296415 AGTCAGTAAGGGTGGGCCTGGGG + Intergenic
1061005019 9:127923793-127923815 CGACCACAGGGGTGGGCCTGAGG + Intronic
1061223619 9:129267230-129267252 GTGCCGCAGGGATGGGACTGTGG + Intergenic
1061550915 9:131334209-131334231 AGGCTGCTGGCGGGGGCCTGTGG + Intergenic
1061615181 9:131774629-131774651 AAGCCGCAGGGGAGGGAGTGGGG - Intergenic
1061744886 9:132732449-132732471 GGGCTGCAGGGCTGGGCCTGAGG + Intronic
1061811315 9:133164010-133164032 AGGCCGCAGGGAAGGGGCTCTGG - Intergenic
1061817743 9:133206706-133206728 AGAGCTCAGGGGTGGGACTGGGG + Intronic
1061853504 9:133429282-133429304 AGGACGCAGGGGTGGGCGCAGGG - Intronic
1061922046 9:133787783-133787805 GGACTGCAGAGGTGGGCCTGTGG - Intronic
1061924686 9:133800250-133800272 GGGCCACAGGGGTGGGCTGGGGG - Intronic
1062035191 9:134379809-134379831 AGGCCCCAGGGTTGGAGCTGGGG - Intronic
1062135181 9:134923038-134923060 AGGCCGCAGAGGCTGTCCTGGGG - Intergenic
1062242650 9:135548478-135548500 AGAGCTCAGGGGTGGGACTGGGG - Intronic
1062242670 9:135548562-135548584 AGAGCTCAGGGGTGGGGCTGGGG - Intronic
1062274047 9:135722280-135722302 CGGCCCCAGGGGTGGGACGGGGG - Intronic
1062282745 9:135759289-135759311 GTGACACAGGGGTGGGCCTGGGG - Intronic
1062360450 9:136185665-136185687 GGGCGGCAGGGATGGGCGTGGGG + Intergenic
1062394739 9:136348254-136348276 AGGCAGGTGGGGCGGGCCTGTGG - Intronic
1062398822 9:136363581-136363603 AGGCGGCGGGCCTGGGCCTGGGG - Exonic
1062452318 9:136620881-136620903 ATGCCGCAGGGGTGGCCCCATGG - Intergenic
1062472045 9:136710405-136710427 AGAAAGGAGGGGTGGGCCTGGGG - Intergenic
1062477322 9:136735193-136735215 AGGCAGCAGGGAGTGGCCTGAGG - Intergenic
1062519119 9:136950325-136950347 GGGCGGCAGGAGTGGGTCTGGGG + Intronic
1062522471 9:136963989-136964011 GGGCTGCAGGGCTGGGGCTGGGG + Intergenic
1062591805 9:137277796-137277818 AGGGCGAGGGGGTGGGCCAGGGG - Exonic
1186190315 X:7061580-7061602 AGGCAGCGGGGGTGGGGGTGGGG - Intronic
1187991415 X:24877497-24877519 AGGCTGGAGGAGGGGGCCTGAGG + Intronic
1189121537 X:38400489-38400511 AGGCAGCAGGAGTGGGCAAGAGG + Intronic
1189331709 X:40148298-40148320 AGCCCGCGGGGGTGGGGCCGTGG - Intronic
1193440617 X:81536027-81536049 AGGCAGTAAGGGTGGGGCTGTGG + Intergenic
1195672848 X:107484013-107484035 GGGCTGCAGGGGAGGGGCTGTGG + Intergenic
1198226844 X:134653166-134653188 AGGCCTGAGGAGAGGGCCTGGGG - Intronic
1198312669 X:135436828-135436850 AGGCTGCGGAGCTGGGCCTGTGG + Intergenic
1200108005 X:153725097-153725119 AGGCCCCCGGGGTGGTGCTGGGG - Exonic