ID: 1076403214

View in Genome Browser
Species Human (GRCh38)
Location 10:130196646-130196668
Sequence CCTCAGCTGCAGAAGGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076403207_1076403214 18 Left 1076403207 10:130196605-130196627 CCCGGCTGCCTAGGAGAGACTCC No data
Right 1076403214 10:130196646-130196668 CCTCAGCTGCAGAAGGTTGCAGG No data
1076403211_1076403214 -3 Left 1076403211 10:130196626-130196648 CCAAGGATGCTCACACAGCACCT No data
Right 1076403214 10:130196646-130196668 CCTCAGCTGCAGAAGGTTGCAGG No data
1076403210_1076403214 10 Left 1076403210 10:130196613-130196635 CCTAGGAGAGACTCCAAGGATGC No data
Right 1076403214 10:130196646-130196668 CCTCAGCTGCAGAAGGTTGCAGG No data
1076403208_1076403214 17 Left 1076403208 10:130196606-130196628 CCGGCTGCCTAGGAGAGACTCCA No data
Right 1076403214 10:130196646-130196668 CCTCAGCTGCAGAAGGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076403214 Original CRISPR CCTCAGCTGCAGAAGGTTGC AGG Intergenic
No off target data available for this crispr