ID: 1076403513

View in Genome Browser
Species Human (GRCh38)
Location 10:130197841-130197863
Sequence ACCAGGTGATGCTCCCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076403513_1076403519 -4 Left 1076403513 10:130197841-130197863 CCTGGGGGGGAGCATCACCTGGT No data
Right 1076403519 10:130197860-130197882 TGGTGGAGGAGCATCACCTGGGG No data
1076403513_1076403518 -5 Left 1076403513 10:130197841-130197863 CCTGGGGGGGAGCATCACCTGGT No data
Right 1076403518 10:130197859-130197881 CTGGTGGAGGAGCATCACCTGGG No data
1076403513_1076403523 12 Left 1076403513 10:130197841-130197863 CCTGGGGGGGAGCATCACCTGGT No data
Right 1076403523 10:130197876-130197898 CCTGGGGGGAGCATCACTTGTGG No data
1076403513_1076403530 30 Left 1076403513 10:130197841-130197863 CCTGGGGGGGAGCATCACCTGGT No data
Right 1076403530 10:130197894-130197916 TGTGGGGGAGCATCGCCTGGGGG No data
1076403513_1076403525 14 Left 1076403513 10:130197841-130197863 CCTGGGGGGGAGCATCACCTGGT No data
Right 1076403525 10:130197878-130197900 TGGGGGGAGCATCACTTGTGGGG No data
1076403513_1076403521 -2 Left 1076403513 10:130197841-130197863 CCTGGGGGGGAGCATCACCTGGT No data
Right 1076403521 10:130197862-130197884 GTGGAGGAGCATCACCTGGGGGG No data
1076403513_1076403524 13 Left 1076403513 10:130197841-130197863 CCTGGGGGGGAGCATCACCTGGT No data
Right 1076403524 10:130197877-130197899 CTGGGGGGAGCATCACTTGTGGG No data
1076403513_1076403526 15 Left 1076403513 10:130197841-130197863 CCTGGGGGGGAGCATCACCTGGT No data
Right 1076403526 10:130197879-130197901 GGGGGGAGCATCACTTGTGGGGG No data
1076403513_1076403527 27 Left 1076403513 10:130197841-130197863 CCTGGGGGGGAGCATCACCTGGT No data
Right 1076403527 10:130197891-130197913 ACTTGTGGGGGAGCATCGCCTGG No data
1076403513_1076403517 -6 Left 1076403513 10:130197841-130197863 CCTGGGGGGGAGCATCACCTGGT No data
Right 1076403517 10:130197858-130197880 CCTGGTGGAGGAGCATCACCTGG No data
1076403513_1076403520 -3 Left 1076403513 10:130197841-130197863 CCTGGGGGGGAGCATCACCTGGT No data
Right 1076403520 10:130197861-130197883 GGTGGAGGAGCATCACCTGGGGG No data
1076403513_1076403528 28 Left 1076403513 10:130197841-130197863 CCTGGGGGGGAGCATCACCTGGT No data
Right 1076403528 10:130197892-130197914 CTTGTGGGGGAGCATCGCCTGGG No data
1076403513_1076403529 29 Left 1076403513 10:130197841-130197863 CCTGGGGGGGAGCATCACCTGGT No data
Right 1076403529 10:130197893-130197915 TTGTGGGGGAGCATCGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076403513 Original CRISPR ACCAGGTGATGCTCCCCCCC AGG (reversed) Intergenic