ID: 1076403516

View in Genome Browser
Species Human (GRCh38)
Location 10:130197858-130197880
Sequence CCAGGTGATGCTCCTCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076403516_1076403525 -3 Left 1076403516 10:130197858-130197880 CCTGGTGGAGGAGCATCACCTGG No data
Right 1076403525 10:130197878-130197900 TGGGGGGAGCATCACTTGTGGGG No data
1076403516_1076403534 29 Left 1076403516 10:130197858-130197880 CCTGGTGGAGGAGCATCACCTGG No data
Right 1076403534 10:130197910-130197932 CTGGGGGGTAGCATAACCTTGGG No data
1076403516_1076403528 11 Left 1076403516 10:130197858-130197880 CCTGGTGGAGGAGCATCACCTGG No data
Right 1076403528 10:130197892-130197914 CTTGTGGGGGAGCATCGCCTGGG No data
1076403516_1076403533 28 Left 1076403516 10:130197858-130197880 CCTGGTGGAGGAGCATCACCTGG No data
Right 1076403533 10:130197909-130197931 CCTGGGGGGTAGCATAACCTTGG No data
1076403516_1076403526 -2 Left 1076403516 10:130197858-130197880 CCTGGTGGAGGAGCATCACCTGG No data
Right 1076403526 10:130197879-130197901 GGGGGGAGCATCACTTGTGGGGG No data
1076403516_1076403524 -4 Left 1076403516 10:130197858-130197880 CCTGGTGGAGGAGCATCACCTGG No data
Right 1076403524 10:130197877-130197899 CTGGGGGGAGCATCACTTGTGGG No data
1076403516_1076403531 14 Left 1076403516 10:130197858-130197880 CCTGGTGGAGGAGCATCACCTGG No data
Right 1076403531 10:130197895-130197917 GTGGGGGAGCATCGCCTGGGGGG No data
1076403516_1076403529 12 Left 1076403516 10:130197858-130197880 CCTGGTGGAGGAGCATCACCTGG No data
Right 1076403529 10:130197893-130197915 TTGTGGGGGAGCATCGCCTGGGG No data
1076403516_1076403530 13 Left 1076403516 10:130197858-130197880 CCTGGTGGAGGAGCATCACCTGG No data
Right 1076403530 10:130197894-130197916 TGTGGGGGAGCATCGCCTGGGGG No data
1076403516_1076403523 -5 Left 1076403516 10:130197858-130197880 CCTGGTGGAGGAGCATCACCTGG No data
Right 1076403523 10:130197876-130197898 CCTGGGGGGAGCATCACTTGTGG No data
1076403516_1076403527 10 Left 1076403516 10:130197858-130197880 CCTGGTGGAGGAGCATCACCTGG No data
Right 1076403527 10:130197891-130197913 ACTTGTGGGGGAGCATCGCCTGG No data
1076403516_1076403535 30 Left 1076403516 10:130197858-130197880 CCTGGTGGAGGAGCATCACCTGG No data
Right 1076403535 10:130197911-130197933 TGGGGGGTAGCATAACCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076403516 Original CRISPR CCAGGTGATGCTCCTCCACC AGG (reversed) Intergenic