ID: 1076403522

View in Genome Browser
Species Human (GRCh38)
Location 10:130197876-130197898
Sequence CCACAAGTGATGCTCCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076403522_1076403537 14 Left 1076403522 10:130197876-130197898 CCTGGGGGGAGCATCACTTGTGG No data
Right 1076403537 10:130197913-130197935 GGGGGTAGCATAACCTTGGGGGG No data
1076403522_1076403534 11 Left 1076403522 10:130197876-130197898 CCTGGGGGGAGCATCACTTGTGG No data
Right 1076403534 10:130197910-130197932 CTGGGGGGTAGCATAACCTTGGG No data
1076403522_1076403527 -8 Left 1076403522 10:130197876-130197898 CCTGGGGGGAGCATCACTTGTGG No data
Right 1076403527 10:130197891-130197913 ACTTGTGGGGGAGCATCGCCTGG No data
1076403522_1076403536 13 Left 1076403522 10:130197876-130197898 CCTGGGGGGAGCATCACTTGTGG No data
Right 1076403536 10:130197912-130197934 GGGGGGTAGCATAACCTTGGGGG No data
1076403522_1076403542 29 Left 1076403522 10:130197876-130197898 CCTGGGGGGAGCATCACTTGTGG No data
Right 1076403542 10:130197928-130197950 TTGGGGGGAGCATCGCCTGGGGG No data
1076403522_1076403538 26 Left 1076403522 10:130197876-130197898 CCTGGGGGGAGCATCACTTGTGG No data
Right 1076403538 10:130197925-130197947 ACCTTGGGGGGAGCATCGCCTGG No data
1076403522_1076403541 28 Left 1076403522 10:130197876-130197898 CCTGGGGGGAGCATCACTTGTGG No data
Right 1076403541 10:130197927-130197949 CTTGGGGGGAGCATCGCCTGGGG No data
1076403522_1076403531 -4 Left 1076403522 10:130197876-130197898 CCTGGGGGGAGCATCACTTGTGG No data
Right 1076403531 10:130197895-130197917 GTGGGGGAGCATCGCCTGGGGGG No data
1076403522_1076403530 -5 Left 1076403522 10:130197876-130197898 CCTGGGGGGAGCATCACTTGTGG No data
Right 1076403530 10:130197894-130197916 TGTGGGGGAGCATCGCCTGGGGG No data
1076403522_1076403543 30 Left 1076403522 10:130197876-130197898 CCTGGGGGGAGCATCACTTGTGG No data
Right 1076403543 10:130197929-130197951 TGGGGGGAGCATCGCCTGGGGGG No data
1076403522_1076403540 27 Left 1076403522 10:130197876-130197898 CCTGGGGGGAGCATCACTTGTGG No data
Right 1076403540 10:130197926-130197948 CCTTGGGGGGAGCATCGCCTGGG No data
1076403522_1076403533 10 Left 1076403522 10:130197876-130197898 CCTGGGGGGAGCATCACTTGTGG No data
Right 1076403533 10:130197909-130197931 CCTGGGGGGTAGCATAACCTTGG No data
1076403522_1076403529 -6 Left 1076403522 10:130197876-130197898 CCTGGGGGGAGCATCACTTGTGG No data
Right 1076403529 10:130197893-130197915 TTGTGGGGGAGCATCGCCTGGGG No data
1076403522_1076403535 12 Left 1076403522 10:130197876-130197898 CCTGGGGGGAGCATCACTTGTGG No data
Right 1076403535 10:130197911-130197933 TGGGGGGTAGCATAACCTTGGGG No data
1076403522_1076403528 -7 Left 1076403522 10:130197876-130197898 CCTGGGGGGAGCATCACTTGTGG No data
Right 1076403528 10:130197892-130197914 CTTGTGGGGGAGCATCGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076403522 Original CRISPR CCACAAGTGATGCTCCCCCC AGG (reversed) Intergenic