ID: 1076403527

View in Genome Browser
Species Human (GRCh38)
Location 10:130197891-130197913
Sequence ACTTGTGGGGGAGCATCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076403516_1076403527 10 Left 1076403516 10:130197858-130197880 CCTGGTGGAGGAGCATCACCTGG No data
Right 1076403527 10:130197891-130197913 ACTTGTGGGGGAGCATCGCCTGG No data
1076403522_1076403527 -8 Left 1076403522 10:130197876-130197898 CCTGGGGGGAGCATCACTTGTGG No data
Right 1076403527 10:130197891-130197913 ACTTGTGGGGGAGCATCGCCTGG No data
1076403513_1076403527 27 Left 1076403513 10:130197841-130197863 CCTGGGGGGGAGCATCACCTGGT No data
Right 1076403527 10:130197891-130197913 ACTTGTGGGGGAGCATCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076403527 Original CRISPR ACTTGTGGGGGAGCATCGCC TGG Intergenic