ID: 1076405782

View in Genome Browser
Species Human (GRCh38)
Location 10:130211893-130211915
Sequence CTGGGTCTAAACTCCCTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076405778_1076405782 12 Left 1076405778 10:130211858-130211880 CCGGCATTACTTCCAGAGCTTGC No data
Right 1076405782 10:130211893-130211915 CTGGGTCTAAACTCCCTTCATGG No data
1076405779_1076405782 0 Left 1076405779 10:130211870-130211892 CCAGAGCTTGCTCTTTGACACAG No data
Right 1076405782 10:130211893-130211915 CTGGGTCTAAACTCCCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076405782 Original CRISPR CTGGGTCTAAACTCCCTTCA TGG Intergenic
No off target data available for this crispr