ID: 1076408630

View in Genome Browser
Species Human (GRCh38)
Location 10:130230611-130230633
Sequence AGCTGGCCTCCACTGAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076408621_1076408630 14 Left 1076408621 10:130230574-130230596 CCCTCCCAGGGGCTTGGGAGAGG No data
Right 1076408630 10:130230611-130230633 AGCTGGCCTCCACTGAAGGGAGG No data
1076408624_1076408630 10 Left 1076408624 10:130230578-130230600 CCCAGGGGCTTGGGAGAGGCACT No data
Right 1076408630 10:130230611-130230633 AGCTGGCCTCCACTGAAGGGAGG No data
1076408623_1076408630 13 Left 1076408623 10:130230575-130230597 CCTCCCAGGGGCTTGGGAGAGGC No data
Right 1076408630 10:130230611-130230633 AGCTGGCCTCCACTGAAGGGAGG No data
1076408625_1076408630 9 Left 1076408625 10:130230579-130230601 CCAGGGGCTTGGGAGAGGCACTG No data
Right 1076408630 10:130230611-130230633 AGCTGGCCTCCACTGAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076408630 Original CRISPR AGCTGGCCTCCACTGAAGGG AGG Intergenic
No off target data available for this crispr