ID: 1076409561

View in Genome Browser
Species Human (GRCh38)
Location 10:130236191-130236213
Sequence CTTATCCGTGATGGGTAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076409556_1076409561 1 Left 1076409556 10:130236167-130236189 CCTTTGAGTCTCTGGGAATTTCA No data
Right 1076409561 10:130236191-130236213 CTTATCCGTGATGGGTAATGGGG No data
1076409553_1076409561 12 Left 1076409553 10:130236156-130236178 CCTCAGAAATTCCTTTGAGTCTC No data
Right 1076409561 10:130236191-130236213 CTTATCCGTGATGGGTAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076409561 Original CRISPR CTTATCCGTGATGGGTAATG GGG Intergenic
No off target data available for this crispr