ID: 1076410317

View in Genome Browser
Species Human (GRCh38)
Location 10:130244600-130244622
Sequence CACCTGCCCCTGCTCTTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076410309_1076410317 27 Left 1076410309 10:130244550-130244572 CCCTGTCCCTTGTGGCCTGAAGT No data
Right 1076410317 10:130244600-130244622 CACCTGCCCCTGCTCTTGACAGG No data
1076410313_1076410317 12 Left 1076410313 10:130244565-130244587 CCTGAAGTCCACAGAGTCACTTG No data
Right 1076410317 10:130244600-130244622 CACCTGCCCCTGCTCTTGACAGG No data
1076410310_1076410317 26 Left 1076410310 10:130244551-130244573 CCTGTCCCTTGTGGCCTGAAGTC No data
Right 1076410317 10:130244600-130244622 CACCTGCCCCTGCTCTTGACAGG No data
1076410311_1076410317 21 Left 1076410311 10:130244556-130244578 CCCTTGTGGCCTGAAGTCCACAG No data
Right 1076410317 10:130244600-130244622 CACCTGCCCCTGCTCTTGACAGG No data
1076410312_1076410317 20 Left 1076410312 10:130244557-130244579 CCTTGTGGCCTGAAGTCCACAGA No data
Right 1076410317 10:130244600-130244622 CACCTGCCCCTGCTCTTGACAGG No data
1076410308_1076410317 28 Left 1076410308 10:130244549-130244571 CCCCTGTCCCTTGTGGCCTGAAG No data
Right 1076410317 10:130244600-130244622 CACCTGCCCCTGCTCTTGACAGG No data
1076410316_1076410317 4 Left 1076410316 10:130244573-130244595 CCACAGAGTCACTTGGGCATGAC No data
Right 1076410317 10:130244600-130244622 CACCTGCCCCTGCTCTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076410317 Original CRISPR CACCTGCCCCTGCTCTTGAC AGG Intergenic
No off target data available for this crispr