ID: 1076413668

View in Genome Browser
Species Human (GRCh38)
Location 10:130269823-130269845
Sequence AGGTCTTGGTGCTCACTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076413668_1076413674 18 Left 1076413668 10:130269823-130269845 CCTCATAGTGAGCACCAAGACCT No data
Right 1076413674 10:130269864-130269886 GAACAGCTTGTCCAGGGTGCCGG No data
1076413668_1076413670 -4 Left 1076413668 10:130269823-130269845 CCTCATAGTGAGCACCAAGACCT No data
Right 1076413670 10:130269842-130269864 ACCTGTTCACAGAAAACTGCTGG No data
1076413668_1076413673 12 Left 1076413668 10:130269823-130269845 CCTCATAGTGAGCACCAAGACCT No data
Right 1076413673 10:130269858-130269880 CTGCTGGAACAGCTTGTCCAGGG No data
1076413668_1076413672 11 Left 1076413668 10:130269823-130269845 CCTCATAGTGAGCACCAAGACCT No data
Right 1076413672 10:130269857-130269879 ACTGCTGGAACAGCTTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076413668 Original CRISPR AGGTCTTGGTGCTCACTATG AGG (reversed) Intergenic
No off target data available for this crispr