ID: 1076413673

View in Genome Browser
Species Human (GRCh38)
Location 10:130269858-130269880
Sequence CTGCTGGAACAGCTTGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076413669_1076413673 -2 Left 1076413669 10:130269837-130269859 CCAAGACCTGTTCACAGAAAACT No data
Right 1076413673 10:130269858-130269880 CTGCTGGAACAGCTTGTCCAGGG No data
1076413671_1076413673 -8 Left 1076413671 10:130269843-130269865 CCTGTTCACAGAAAACTGCTGGA No data
Right 1076413673 10:130269858-130269880 CTGCTGGAACAGCTTGTCCAGGG No data
1076413668_1076413673 12 Left 1076413668 10:130269823-130269845 CCTCATAGTGAGCACCAAGACCT No data
Right 1076413673 10:130269858-130269880 CTGCTGGAACAGCTTGTCCAGGG No data
1076413667_1076413673 15 Left 1076413667 10:130269820-130269842 CCACCTCATAGTGAGCACCAAGA No data
Right 1076413673 10:130269858-130269880 CTGCTGGAACAGCTTGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076413673 Original CRISPR CTGCTGGAACAGCTTGTCCA GGG Intergenic
No off target data available for this crispr