ID: 1076420218

View in Genome Browser
Species Human (GRCh38)
Location 10:130326138-130326160
Sequence CTGTGGGGTTGGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076420206_1076420218 13 Left 1076420206 10:130326102-130326124 CCTCTGGAGGCTGCTGTGGATGA No data
Right 1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG No data
1076420201_1076420218 30 Left 1076420201 10:130326085-130326107 CCTGGCCACAGGTCTGACCTCTG No data
Right 1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG No data
1076420213_1076420218 -10 Left 1076420213 10:130326125-130326147 CCTACAGAAGGGGCTGTGGGGTT No data
Right 1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG No data
1076420204_1076420218 25 Left 1076420204 10:130326090-130326112 CCACAGGTCTGACCTCTGGAGGC No data
Right 1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076420218 Original CRISPR CTGTGGGGTTGGAGGGAGGA AGG Intergenic
No off target data available for this crispr