ID: 1076420367

View in Genome Browser
Species Human (GRCh38)
Location 10:130327199-130327221
Sequence GGCCATCTGTTCATTCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076420360_1076420367 -2 Left 1076420360 10:130327178-130327200 CCGCCCCGAGCCACTCTGCACGG No data
Right 1076420367 10:130327199-130327221 GGCCATCTGTTCATTCCAGGAGG No data
1076420362_1076420367 -5 Left 1076420362 10:130327181-130327203 CCCCGAGCCACTCTGCACGGCCA No data
Right 1076420367 10:130327199-130327221 GGCCATCTGTTCATTCCAGGAGG No data
1076420363_1076420367 -6 Left 1076420363 10:130327182-130327204 CCCGAGCCACTCTGCACGGCCAT No data
Right 1076420367 10:130327199-130327221 GGCCATCTGTTCATTCCAGGAGG No data
1076420364_1076420367 -7 Left 1076420364 10:130327183-130327205 CCGAGCCACTCTGCACGGCCATC No data
Right 1076420367 10:130327199-130327221 GGCCATCTGTTCATTCCAGGAGG No data
1076420359_1076420367 15 Left 1076420359 10:130327161-130327183 CCTTGCTGCAAGCATGACCGCCC No data
Right 1076420367 10:130327199-130327221 GGCCATCTGTTCATTCCAGGAGG No data
1076420358_1076420367 29 Left 1076420358 10:130327147-130327169 CCAGGGTTGCTGAGCCTTGCTGC No data
Right 1076420367 10:130327199-130327221 GGCCATCTGTTCATTCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076420367 Original CRISPR GGCCATCTGTTCATTCCAGG AGG Intergenic
No off target data available for this crispr