ID: 1076423615

View in Genome Browser
Species Human (GRCh38)
Location 10:130351709-130351731
Sequence GTGCACACATTCTGCCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076423611_1076423615 5 Left 1076423611 10:130351681-130351703 CCGCATGTGTGCCTGTGTGTGTG No data
Right 1076423615 10:130351709-130351731 GTGCACACATTCTGCCAGCTGGG No data
1076423609_1076423615 12 Left 1076423609 10:130351674-130351696 CCTGTACCCGCATGTGTGCCTGT No data
Right 1076423615 10:130351709-130351731 GTGCACACATTCTGCCAGCTGGG No data
1076423613_1076423615 -6 Left 1076423613 10:130351692-130351714 CCTGTGTGTGTGAAGCGGTGCAC No data
Right 1076423615 10:130351709-130351731 GTGCACACATTCTGCCAGCTGGG No data
1076423610_1076423615 6 Left 1076423610 10:130351680-130351702 CCCGCATGTGTGCCTGTGTGTGT No data
Right 1076423615 10:130351709-130351731 GTGCACACATTCTGCCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076423615 Original CRISPR GTGCACACATTCTGCCAGCT GGG Intergenic
No off target data available for this crispr