ID: 1076425450

View in Genome Browser
Species Human (GRCh38)
Location 10:130364277-130364299
Sequence CCTGCTCTGGAGAAGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076425450_1076425459 25 Left 1076425450 10:130364277-130364299 CCTTGCTCCTTCTCCAGAGCAGG No data
Right 1076425459 10:130364325-130364347 ACCTTTCCCCCTCAAGTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076425450 Original CRISPR CCTGCTCTGGAGAAGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr