ID: 1076426823

View in Genome Browser
Species Human (GRCh38)
Location 10:130372927-130372949
Sequence CCCAACCTGCCAGCCCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076426823_1076426829 30 Left 1076426823 10:130372927-130372949 CCAGGCAGGGCTGGCAGGTTGGG No data
Right 1076426829 10:130372980-130373002 TCCCTCTCCTCTCTACCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076426823 Original CRISPR CCCAACCTGCCAGCCCTGCC TGG (reversed) Intergenic