ID: 1076426825

View in Genome Browser
Species Human (GRCh38)
Location 10:130372950-130372972
Sequence TTGGCTGGACAGCGACGAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076426825_1076426831 8 Left 1076426825 10:130372950-130372972 CCCGTTCGTCGCTGTCCAGCCAA No data
Right 1076426831 10:130372981-130373003 CCCTCTCCTCTCTACCTCCAGGG No data
1076426825_1076426829 7 Left 1076426825 10:130372950-130372972 CCCGTTCGTCGCTGTCCAGCCAA No data
Right 1076426829 10:130372980-130373002 TCCCTCTCCTCTCTACCTCCAGG No data
1076426825_1076426834 19 Left 1076426825 10:130372950-130372972 CCCGTTCGTCGCTGTCCAGCCAA No data
Right 1076426834 10:130372992-130373014 CTACCTCCAGGGTCACCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076426825 Original CRISPR TTGGCTGGACAGCGACGAAC GGG (reversed) Intergenic